SGN Marker d

SGN-M3849
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the dwarf locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40538)
Chromosome
2
Position
108.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35669
Forward primer (5'-3')
GAATGAAGCGAAAGGACTGG
Digested band sizes (using MspI)
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACCGCATTGACCTGTAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
d was used as an overgo probe on plate 13 [well F3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AATGCGGTTCACACGAGCTGTGAT
B sequence
CCTGGAGGTCTCTAAAATCACAGC
AB sequence
AATGCGGTTCACACGAGCTGTGATTTTAGA
Marker sequence
ATGGCCTTCTTCTTAATTTTTCTTTCATCCTTTTTTGGCCTATGTATCTT
TTGTACTGCTTTATTAAGATGGAATCAAGTCAAGTATAACCAAAAAAACT
TGCCCCCTGGTACTATGGGTTGGCCACTTTTTGGTGAAACTACTGAGTTT
CTTAAACTTGGTCCAAGTTTCATGAAAAACCAAAGAGCCAGATATGGGAG
TTTTTTTAAATCACACATACTTGGTTGTCCAACAATTGTTTCAATGGATT
CAGAACTGAACAGATATATACTAGTGAATGAAGCGAAAGGACTGGTCCCA
GGATACCCACAGTCTATGATAGATATTTTAGGAAAATGTAATATTGCAGC
TGTCAATGGTTCAGCTCACAAGTACATGAGGGGTGCATTGTTATCCCTAA
TTAGCCCTACAATGATCAGAGACCAACTTTTGCCTAAAATTGATGAGTTT
ATGAGATCCCACTTAACCAATTGGGATAATAAAGTTATTGACATTCAAGA
GAAAACCAATAAGATGGCATTTCTATCATCGTTGAAGCAAATTGCTGGTA
TTGAATCTACCTCTTTAGCTCAAGAATTCATGTCTGAATTTTTCAATCTA
GTGCTAGGCACTCTTTCACTACCTATCAATCTTCCAAACACCAACTATCA
TCGCGGATTTCAGGCAAGGAAAATTATTGTGAACTTATTACGAACACTCA
TAGAAGAGAGAAGAGCTTCAAAGGAAATTCAACATGATATGCTTGGTTAC
CTGATGAATGAGGAAGCAACACGATTCAAATTAACAGATGATGAGATGAT
TGATTTAATTATAACTATTTTGTACTCTGGATATGAAACTGTTTCCACCA
CTTCTATGATGGCTGTGAAATATCTTCATGATCATCCAAAAGTTCTTGAA
GAACTTAGAAAAGAACACATGGCTATTAGAGAAAAGAAAAAACCTGAGGA
TCCTATCGATTACAACGATTACAGGTCAATGCGGTTCACACGAGCTGTGA
TTTTAGAGACCTCCAGGTTAGCAACAATAGTAAATGGGGTTTTGAGAAAA
ACAACTCAAGATATGGAAATAAATGGGTATATCATTCCTAAAGGATGGAG
AATATACGTATATACAAGGGAGTTGAATTACGATCCAAGACTTTATCCTG
ATCCATATTCGTTCAATCCATGGAGATGGATGGATAAGAGCCTGGAACAC
CAAAACTCATTTTTGGTATTTGGAGGTGGTACTAGACAATGTCCTGGAAA
GGAACTTGGTGTAGCAGAAATTTCCACATTTCTTCATTACTTCGTAACAA
AATACAGATGGGAAGAAATAGGTGGAGATAAACTGATGAAATTCCCAAGA
GTTGAAGCACCAAATGGTCTACGGATTAGAGTTTCAGCTCACTAA
Genomic location of d  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3849 marker 3849
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)