SGN Marker TG49

SGN-M387

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
ATTCGTTTTTATTTACTCTTGCTTTATACCAAAAATTGATAATTTTTTAGATTCACAAATGTGTTGATAGCGGAGGAAAGGTGCTCATCC
CTGCATTTGCTCTTGGAAGAGCTCAGGTTTTTATTCTTTATTTTGGCTACTTTATAAATCAAGTCTATTTTTTTTTTCCTTTTTTCTTTT
TGATAACTGTGGTGTCTGGGCTAGCTTGTGCGTATCTCAACTAATTCTACTGGATACTTATCAATAGGGGTGGGTGTTCGGGTCTTCAGT
TCAATTTTATCAAACTTTGATTCGGTTGTTTGGTTATGGAAACATGTGCAACAAACACCGAACCAATTTAGTTCAGTTTTTCAAAGTTTG
TTCAATTTGGTCTTCTGAAACGTTTTCTCGACGCATATGAGAAACAAAATAAGGACCAAACCAGAATAAATCTAACGTTAATACTATAAT
TATACCAATATATGGTACTAAATTACTAATTAGACCAAAATT
Reverse sequence
TTTTATTTACTCTTGCTTTATACCAAAAATTGATAATTTTTTAGATTCACAAATGTGTTGATAGCGGAGGAAAGGTGCTCATCCCTGCAT
TTGCTCTTGGAAGAGCTCAGGTTTTTATTCTTTATTTTGGCTACTTTATAAATCAAGTCTATTTTTTTTTTCCTTTTTTCTTTTTGATAA
CTGTGGTGTCTGGGCTAGCTTGTGCGTATCTCAACTAATTCTACTGGATACTTATCAATAGGGGTGGGTGTTCGGTTCTTCAGTTCAATT
TTATCAAACTTTGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53860)
Chromosome
4
Position
13.40 cM
Confidence
uncalculated
Protocol
RFLP

2_Isobutylthiazole_content_ibt4_1 2_Methylthio_ethanol_content_meo4_1 Dry_matter_weight_dmw4_1 6_Methylhept_5_en_2_one_content_mhn4_1 Lycopene_content_lyc4_1 2_Methylbut_2_enal_content_bea4_1Color_L_L4_1 Color_a_a4_1Hexanal_content_hxa4_1 3_Methylpentan_1_ol_content_mno4_1 Elasticity_ela4_1 Color_b_b4_1Firmness_fir4_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53338)
Chromosome
4
Position
16.68 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42476)
Chromosome
11
Position
76.70 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9036)
Chromosome
11
Position
83.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9035)
Chromosome
4
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9037)
Chromosome
4
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG49 was used as an overgo probe on plate 9 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGTGTTGATAGCGGAGGAAAGGTG
B sequence
CAAATGCAGGGATGAGCACCTTTC
AB sequence
TGTGTTGATAGCGGAGGAAAGGTGCTCATC
Marker sequence
ATTCGTTTTTATTTACTCTTGCTTTATACCAAAAATTGATAATTTTTTAG
ATTCACAAATGTGTTGATAGCGGAGGAAAGGTGCTCATCCCTGCATTTGC
TCTTGGAAGAGCTCAGGTTTTTATTCTTTATTTTGGCTACTTTATAAATC
AAGTCTATTTTTTTTTTCCTTTTTTCTTTTTGATAACTGTGGTGTCTGGG
CTAGCTTGTGCGTATCTCAACTAATTCTACTGGATACTTATCAATAGGGG
TGGGTGTTCGGGTCTTCAGTTCAATTTTATCAAACTTTGATTCGGTTGTT
TGGTTATGGAAACATGTGCAACAAACACCGAACCAATTTAGTTCAGTTTT
TCAAAGTTTGTTCAATTTGGTCTTCTGAAACGTTTTCTCGACGCATATGA
GAAACAAAATAAGGACCAAACCAGAATAAATCTAACGTTAATACTATAAT
TATACCAATATATGGTACTAAATTACTAATTAGACCAAAATT
Genomic location of TG49  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D387 marker 387
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)