Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker Asc1

SGN-M3877
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the Alternaria stem canker resistance locus.

Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42939)
Chromosome
3
Position
31.80 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43939
Forward primer (5'-3')
ATCACATCGCTGCTTCGGTTG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ATCCCAGTAGTCCGTTCCTTCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38040)
Chromosome
3
Position
105.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35561
Forward primer (5'-3')
TTCTCTCTTTTCGCGTTGGT
Digested band sizes (using ApoI)
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCAAGAGGCTTTGCTAAT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
Asc1 was used as an overgo probe on plate 13 [well C6]

Plausible BAC Matches:   P018H24,   P036B17

 Overgo Sequences

A sequence
CTGCTTCGGTTGATTGGGAGAAAG
B sequence
TACTCAGGGAGAGACTCTTTCTCC
AB sequence
CTGCTTCGGTTGATTGGGAGAAAGAGTCTC
Marker sequence
GGGCCCTGCTCTGATACCATGTGAAATTAGGTCTTAGGCCTAACTCACAC
CCCAAAAGCTAGCTCAAAGGGAGGAGGATTGCCTAAGCCTTGTAAAGAGT
CAACTTATCTCATTAATCACCGATGTGGAATTTTTATCATTCTTTAACAA
AAGTTAGAAATATATTTATATAAAATCGAAACGATCAAACGTGTTAGAGA
ATAATATGTATTATTGTGTCTTAGCTTAGAAAGAAATGTTTGACAGATGT
TAAATGTTTGACTTAATTTTTTTTATTCAAAGCAGTCGATCCGCCAAATA
TGATTTTTCTAAAAAAAGAATTATTCAATCGAAACTTCCGGGACATATCT
CCAAACAGAATCATGGCTTTTGCTACAAAATCATCACCTCGCTCTTTACA
ACCTAACAATTCGAAAACTTGTTCTGCAATTCATTTGAAACTACAACAAT
AGAAGAAGAAAAAAAAGTTCAATTCAACAGATTTTTGAAAAAAAAAGTCA
ACAGATGAAAAACCTGGATCACATCGCTGCTTCGGTTGATTGGGAGAAAG
AGTCTCTCCCTGAGTACCAGGATTTGATATTTCTCTTATTTTTTGCTCTC
TTCTTCCCCGTTCTTCGATTCATACTCGACAGATTTGTTTTCGAGGTAGT
AGCTCGGTTGGTTGGCTATCTCAACTAATTTTGATTAGTTTTTTTCCCAG
TTTTCTTCCCTCCTCTGTTTTTTTTTTCTTTTCTGTTTGAAATTTGAGAT
TGATTTGGACGCGTGCTTATATTGTTTACTCTGATGCTAGGCATTGGCTA
AGCGTATGATTTTTGGAAAGAAGACGGTTGTAAATATTAACGGTCGTGAA
GAGAGGAAGAAGATCAACAAATTCAAAGAGTCAGCATGGAAATTTGTATA
TTTTCTATCTGCTGAGCTACTTGCACTTTCTGTGACTTGTAATGAGCCTT
GGTTCACAGATAGTCGGTATTTCTGGGCAGGACCTGGAGATGTGGTTTGG
CCTAATTTGAAAATGAAGTAAAGCTCTTCTCATTTTTGAAGATTTTGTAT
TGATATCTGAATCAGAAAAGGAGTGTTTATAACCTGGTTGATTCGAATTT
GGCAGATTAAAGCTAAAATTATTGTACATGTATGCTGGAGGATTCTACTT
TTACTCCATATTCGCAACACTTTATTGGGAAACAAGACGCTATGATTTTG
CTGCGCAGATAATTCATCATGTAACAACAGTGTCACTCATTGTGTTGTCT
TACGTATACGGGTACAGCCATTTGCTCAGCTGTTATAAAAGTGTTGGTGT
GAGTTTAGTTTTGAAGAATGTGAACATTCTGTTTTGCAGGTTTGCGCGTA
TTGGATCAGTGGTTCTAGCACTTCATGACGGAAGTGATGTATTCATGGAA
ATTGCAAAGATGTCGAAATACAGTGGCTTTGATTTGATTGCTGATATTTT
CTTCTCTCTTTTCGCGTTGGTTTTTACATCACTTCGTATAATCTGCTATC
CCTTCTGGATAATCCGAAGCACATGGTGAGTTCACTACCAACTGCATTTA
CAGTAAGCTTGTTTTCTGTTAGTTCATCGTCTCTAAGATTCGTTATTTCT
TTCAACTTTGTGCAGCTACGAACTTCTTTATGTATTGGATATACAGAAGG
AACGGACTACTGGGATCATACTTTACTTTGTTTTCAATGCATTGCTGATA
TGCTTGCTGGTTCTTCACCTCTTTTGGTTCAAAATCATACTGCGGATGGT
CAAGAACCAAATCCTATCAAGAGGCCACATTACTGATGATGTTCGAGAAG
GTAAAAGAATCATCTGCTTCATTGATCATATAAACTTCCAGCATGATAGC
TTTTGATCTTACACTGCATTTTTGTTTATGATCTGCAGATTCTGAATCTG
ATGATGACCACAAAGACTGATCCTTCAGTAGCTAAGACCAAAAGTACAAT
TCATGGTCCAGGCTGATGTTTGAAGCATTTAAATATTTTGTATTTCTTGT
AGAGGCAGCACTACTTGATGTCGATGAACAAATTGAACATAGGGAATTAT
AGTGAAAATCTTTATTCTGGGTTCCATTCATGAGTTTTGCCTGTATGTAT
AAGAAAAAAGTTGCACTGTTGGAATTATGTATATCCTGATATGCTATTTG
GATGAACTGTCAATTTAATTCGTTTAAATTTCTTCATCTCTGAAGTCTAA
ACAGCTAAATTGACAGAATATTTCGCCATTGACCAACTATAAACAATAAT
TTTGAAGAAAGAACATATGATTAGCAAAGCCTCTTGCCACAAATATAACC
TAAACAAGAGCAAAATATTGCTGCTTCTCTCACATTTCAACAGGGAAAAG
TCAAGAATGAATAGTAACTTTGCAGTAAATTATGTAACAAAAGCTAAGTG
ATGCTATAAGATGATTCATCTGTAAACTAACCCCACAAATCTTGTCCTAT
CTTTTCA
Genomic location of Asc1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3877 marker 3877
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)