SGN Marker C2_At1g61620

SGN-M3879
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302818 (SGN)
125016 (CGN)
---
Capsicum annuumSingleSGN-U197742---
Lycopersicon CombinedSingleSGN-U216182---
Solanum tuberosumSingleSGN-U248230---
ArabidopsisSingleAt1g61620 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46599)
Chromosome
2
Position
6.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38222)
Chromosome
3
Position
106.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39494
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
Accessions and product sizes
Solanum lycopersicum TA209
320
Solanum pennellii TA56
340
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
340
Solanum lycopersicum TA209
320
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25335)
Chromosome
1
Position
22.74 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10319
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 340
Approximate temperature
55°C
  
PCR data   Exp. ID 10320
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 12754
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12755
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 12756
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 12757
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 12758
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 12759
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 12760
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32221
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 32603
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32817
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32818
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32819
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 32820
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 32821
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 10321
Forward primer (5'-3')
ATGCATTCTAGAATGCCTTTTGTC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 340
Solanum lycopersicum LA925: 320
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCCCTGGCTTTCTGCAGCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference, HaeIII, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 340
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g61620 was used as an overgo probe on plate 12 [well H2]

Plausible BAC Matches:   P286H14,   P024I16,   P018N14,   P183L18,   P054D24,   P187L20,   P096I05,   P256K09,   P284H16,   P283O10,   P126D19

 Non-Plausible BAC matches

P078P08,   P156O06,   P166G08,   P124N18,   P059M17

 Overgo Sequences

A sequence
TGGAAAAGGGAGGAACAGGGTTTG
B sequence
TTATCTCCATGGGCAGCAAACCCT
AB sequence
TGGAAAAGGGAGGAACAGGGTTTGCTGCCC
Marker sequence
ATGCCGCAGAGACACTCGAAGAACAACAACGATCTTGCCTTCTTTACGTA
CGATGAGAAGAGAAAGTTAGGGTATGGAACACAAAAGGAGAGGCTGGGAA
AAGATTCAATCAAGCCATTCGATGCTTGTTCCCTTTGTTTAAAACCCTTC
ATCGATCCGTTGTGTTGCCAGAAAGGGCATGTCTTTTGCAAAGAATGCAT
TCTAGAATGCCTTTTGTCCCAGAAAAAGGATATCCAAAGANNNNNAAGTT
AGCTGCTCATACAGGTCAGCAGAAGCAAGAAAAAGAAGAGGAAGAGGAGA
GGTTGATGCTGCAGAAAGCCAGGGATCTTGATGCATTTGATCAACAAAAT
CATGGTCCAGTTCCGCAGTACAATGATAAGAACTACAACAGAGACAAAAA
TGGATTCCATGGAGCTAACAGTGTGAAAGCTACTTCTTATGAGGAGGAAG
CACTTAGAACCATGAAAGCATTTTGGCTGCCCTCTGCAACACCAGATGCA
CCTGCTAAGGTGGAAGCCCCATCCACTAGCACAACTTGTCCTGAAGGGAG
GGAAAAAATTAAGATGAAAAACCTTTTCCCTATACACTTCACTGAAGATA
CAAGTGCACAGAAGAAACACAAGTCTCTTGACAAGAGTTTCATATGTCCC
AGTTGCAAGGTCACACTAACCAATACTTTGTCACTTGTAGCACTTAATAC
TTGTGGACATGTCTTCTGCAAGAAATGTGCAGAAAAATTTGTGGCTGTTG
ACAAGGTTTGCGTGGTCTGTGACAAACCATGTAAAAATAGAAATCTGGTG
AATGTGGAAAAGGGAGGAACAGGGTTTGCTGCCCATGGAGATAATCTTGA
AGCAAAAGACTTCAAACACTTGGGGAGTGGAAGT
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g61620  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3879 marker 3879
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)