SGN Marker C2_At1g55170

SGN-M3883
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311064 (SGN)
128913 (CGN)
---
Capsicum annuumSingleSGN-U197903---
Lycopersicon CombinedSingleSGN-U219437---
Solanum tuberosumMultipleSGN-U246518---
ArabidopsisSingleAt1g55170 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38206)
Chromosome
3
Position
158.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39481
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
50°C
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
480
Solanum pennellii TA56
380
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25286)
Chromosome
1
Position
20.58 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10275
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
50°C
  
PCR data   Exp. ID 10276
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
50°C
  
PCR data   Exp. ID 10277
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
50°C
  
PCR data   Exp. ID 12714
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32601
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32801
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32802
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10278
Forward primer (5'-3')
ATTCGCTCCAGGGAACTTATCG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 480
Solanum pennellii LA716: 380
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTAACCAAATTTGTCTCCATTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI, EcoRV
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g55170 was used as an overgo probe on plate 12 [well H5]

Plausible BAC Matches:   P212K06

 Overgo Sequences

A sequence
CCTTGCCATAGGTGATATGCAAGC
B sequence
GCGAATTTCATGCTCCGCTTGCAT
AB sequence
CCTTGCCATAGGTGATATGCAAGCGGAGCA
Marker sequence
ATGGCAGGAAGAAATCGCGTTCCTCGGGAAGCATTTGATAACCGCCGGGG
CTTTCCTGCAGAAGGGCATATTGCCCGGGGTCCTATGCCTCGACCCTCTC
TCCATCCTGCGTTGTTAGAAGAGGAACTTGAAATACAACATCTTGAGATA
CGCAGACTTCTGGGTGAAAACAGGAGATTAGTTGAAGATCGAATAGCTCT
GCAACGGGAATCAGCTGCTGCAAAGGAGGAGGTTTATCGAATGAACCTTG
CCATAGGTGATATGCAAGCGGAGCATGAAATTCGCTCCAGGGAACTTATC
GAAAGAGGTTTAAAGCTTGAAGGAGATCTTCGAGCTACAGAACCTCTGAA
AAATGAGGCTAAACAGCTCCATGTTGAAGTTCAGAAGCTAAATATTATGA
AGCAGGATCTAACTGGCCAGGTGCAGACCCTCACCAAGGACCTTGCCAAG
CTACAAGCTGATATCCAACAGATTCCTCATTTCAGGGGTGAGATTGATGG
GCTTCATCAAGAGCTTTTGCGCGCTAGNNNNNGTCTGCCATTGAGTATGA
AAAGAAGGCAAAAATTGAACTCATGGATCAGAGACAGGCAATGGAGACAA
ATTTGGTTACTATGGCACGTGAAGTTGAGAAGCTACGAGCCGAGCTTTCT
AATTCTGATGGTAGAGCATGGGCTGCAGGTNNNNNGGATCATATGGGATG
AGATATGGAAGACATGATGCAAGTTTCCCTGCACCTTATGGCGAGGGATA
TGGGGTCCATATGGGTGCTGCTGNNNNNACAGGGGTCCTTTGTATGGTGC
TGCTTCAGCTTCACGGGGAGGACTTGAGAAACCTCAAATGAATCGTCGCT
GA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g55170  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3883 marker 3883
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)