Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker U43768

SGN-M3894

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U43768
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40260)
Chromosome
4
Position
38.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14100
Forward primer (5'-3')
GAATGGGTTGTTCTCGGCTA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CATTGAGCAATTCACAAGTCG
Enzymes
  
Accessions and product sizes
Approximate temperature
Unknown
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of U43768  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3894 marker 3894
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)