SGN Marker TG498

SGN-M390

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAAAATTAACGGATTCTGCCCACCGTAGCCTTGCGGATCACCTCACTGCCTCTCGCATGGATGACCTTCTTAGTTATCCTGATAGGCTGT
CTGAAGAAATAGTCAAATGCATATCTTGTATATACTGCAAATTTGCCAATCCCAATATTCTTGCTCCAAAGGGATTATCAGTTTCTTCTA
CTTCGTCATTGTCATCATCAAGCACATTTTCTCCGAGAAATCTTTCGGGCAGCTGGAGCTCACATCACAATGAGGAGAGCACTGAGCAGT
ATGAATTTGAAGTGATAGAAATTTTGAAGATATGTCTAGATGATGATAGTTTCAATTATGCCACAACAATGCTGCATAAGTTCAGGTTAT
TTGCAACAAACACAAGTAGTTCAAATAGAGTTAAAGAGTACAAAAATCTTCAATACCTGCTAGTGTGGACTTGATTAAAAAGCATGTTAA
G
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGAGCATCAACGTAGTAAAAATAAAACTTATATACTACTATATTGAGTATATTCAGATTGTATTGTCAT
TTCTCCATTTAGAAGTTGCATCTTCTCTTTAGCCTTGATTGGTGGAGAAAGGAGGGAGAAAAGTGACAATTATTTATAAAAACAATTTCT
GATGCAGTAGAACTTACCATTTAGATGGAACATTTTACAGCTTTCAAATTAGTATGACAAATTCAAATTGGTGAATTAAGCTTGTCGAAC
ACTTCTTAACATGCTTTTTAATCAAGTCCACACTAGCAGGTATTGAAGATTTTTGTACTCTTTAACTCTATTTGAACTACTTGTGTTTGT
TGCAAATAACCTGAACTTATGCAGCATTGTTGTGGCATAATTGAAACTATCATCATCTAGACATATCTTCAAAATTTCTATCACTTCAAA
TTCATACTGCTCAGTGCTCTCCTCATTGTGATGTGAGCTCCAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U152213356 (78.9% of RFLP seq)+
SGN-U1522137.3e-65124 (25.2% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53898)
Chromosome
4
Position
40.50 cM
Confidence
uncalculated
Protocol
RFLP

2_Isobutylthiazole_content_ibt4_1 2_Methylthio_ethanol_content_meo4_1 Dry_matter_weight_dmw4_1 6_Methylhept_5_en_2_one_content_mhn4_1 Lycopene_content_lyc4_1 2_Methylbut_2_enal_content_bea4_1Color_L_L4_1 Color_a_a4_1Hexanal_content_hxa4_1 3_Methylpentan_1_ol_content_mno4_1 Elasticity_ela4_1 Color_b_b4_1Firmness_fir4_1
Tomato QTL map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40065)
Chromosome
4
Position
135.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9039)
Chromosome
4
Position
124.40 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35632
Forward primer (5'-3')
CAGCTGGAGCTCACATCACAA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GTGGAGAAAGGAGGGAGAAAAGT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 375
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
TG498 was used as an overgo probe on plate 9 [well C10]

Plausible BAC Matches:   P122M18,   P120F21

 Overgo Sequences

A sequence
TGGAGCTCACATCACAATGAGGAG
B sequence
CATACTGCTCAGTGCTCTCCTCAT
AB sequence
TGGAGCTCACATCACAATGAGGAGAGCACT
Marker sequence
AAAAATTAACGGATTCTGCCCACCGTAGCCTTGCGGATCACCTCACTGCC
TCTCGCATGGATGACCTTCTTAGTTATCCTGATAGGCTGTCTGAAGAAAT
AGTCAAATGCATATCTTGTATATACTGCAAATTTGCCAATCCCAATATTC
TTGCTCCAAAGGGATTATCAGTTTCTTCTACTTCGTCATTGTCATCATCA
AGCACATTTTCTCCGAGAAATCTTTCGGGCAGCTGGAGCTCACATCACAA
TGAGGAGAGCACTGAGCAGTATGAATTTGAAGTGATAGAAATTTTGAAGA
TATGTCTAGATGATGATAGTTTCAATTATGCCACAACAATGCTGCATAAG
TTCAGGTTATTTGCAACAAACACAAGTAGTTCAAATAGAGTTAAAGAGTA
CAAAAATCTTCAATACCTGCTAGTGTGGACTTGATTAAAAAGCATGTTAA
G
Genomic location of TG498  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D390 marker 390
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)