SGN Marker U214856

SGN-M3910

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U214856
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40204)
Chromosome
4
Position
93.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14042
Forward primer (5'-3')
TCAAAGAATGCGAGAGAAAGCTGC
Digested band sizes (using RsaI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 350
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCATATGCTTTCAACTCTTCACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 400
Approximate temperature
50°C
  
PCR data   Exp. ID 14042
Forward primer (5'-3')
TCAAAGAATGCGAGAGAAAGCTGC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCATATGCTTTCAACTCTTCACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U214856 was used as an overgo probe on plate 13 [well A7]

Plausible BAC Matches:   P253P22,   P259D09,   P209P10,   P257F01,   P128L09,   P261A20

 Overgo Sequences

A sequence
AAATGATGGCTCGGCAACTAGCAC
B sequence
CAGCGTAGTTGTAGTGGTGCTAGT
AB sequence
AAATGATGGCTCGGCAACTAGCACCACTAC
Marker sequence
ATGGTGGATTTAGGTCTCTTCGGATCTCTTCTTGTAGTGGTGTTGGGGTT
CGTTGCAGTTTTCTGTTTTTTCATTGGTCGTAACAAAAGTAAAAATGATG
GCTCGGCAACTAGCACCACTACAACTACGCTGTATAATGGAGAGTCCAGA
TCAAAGGATGGAAACGAAGACGTTGATATCATCATCGTCGGTGCCGGTGT
TGCCGGTGCTGCTCTTGCTCACACTCTTGGCANNNNNAGGAGGGGCGTCG
TGTAAAAGTAATTGAAAGAGATTTGACGGAGCCTGATCGAATTGTTGGAG
AACTCCTACAACCGGGTGGTTATCTCAAATTGCAGGAGTTGGGATTGGAN
NNNNAGATTGTGTTGAGAAAATTGATGCTCAACGCGTTTTTGGGTATGCC
CTTTTCAAGGATGGAAAGAGTACACGTCTTTCTTATCCCCTGGAGAAATT
TCACTCTGATGTTTCTGGAAGGAGCTTCCACAATGGGCGTTTCATTCAAA
GAATGCGAGAGAAAGCTGCAGCTCTTCCCAANNNNNTGTCAAACTCGAGC
AAGGTACTGTTACGTCTCTGCTTGAAGAAAAGGGGATCATTAGAGGTGTT
CAGTACAAGACTAAATCCGGTGAAGAGTTGAAAGCATATGCACCATTAAC
TGTAGTATGTGATGGTTGTTTCTCGAATCTGCGACGTACCCTCTGTGATC
CANNNNNAAGGTAGAAGTCCCTTCTTGTTTTGTTGGTCTGGTCCTGGAGA
ACTGTCAGCTTCCACATGAAAATCACGGACATGTCATTTTGGCTGATCCG
TCACCTATCTTGTTCTATCCCATAAGCAGTACTGAAGTCCGCTGTCTGGT
TGATGTACCTGGTCAAAAAGTGCCTTCTATTTCGAATGGTGAAATGGCCA
AATATTTGAAAAGTGTAGTTGCTCCCCNNNNNAGGTCCCTCCTGAGATAA
AAGATGCATTCATTGCTGCAATTGATAAAGGAAACATCAGGACAATGCCC
AACCGAAGCATGCCAGCTGCTCCTCATCCTACTCCTGGTGCTCTTCTCAT
GGGTGATGCATTCAACATGCGCCACCCCTTGACTGGTGGAGGAATGACTG
TAGCATTATCTGATATCGTTGTATTGCGTGATCTTCTCAAACCTCTTCGT
AATTTGAATGATGCATCTACTCTTTGCAGATATCTGGAGTCATTTTACAC
CTTGCGTAA
Genomic location of U214856  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3910 marker 3910
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)