SGN Marker ANTL

SGN-M3911
KFG markers are Known Function Genes

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-NM06   
Map version
172 (location: 129204)
Chromosome
1
Position
83.95 cM
Confidence
uncalculated
Protocol
unknown


Pepper-NM06

Map: Pepper-FA07   
Map version
170 (location: 117129)
Chromosome
3
Position
64.39 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FA07

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38039)
Chromosome
4
Position
94.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13950
Forward primer (5'-3')
TCCACAGGAAATCCATTGAC
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 450+1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTAGTTCTCTTAGCTAATTCACCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1650
Approximate temperature
60°C
  
PCR data   Exp. ID 13950
Forward primer (5'-3')
TCCACAGGAAATCCATTGAC
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 450+1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTTTAGTTCTCTTAGCTAATTCACCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1650
Approximate temperature
60°C
  
Genomic location of ANTL  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3911 marker 3911
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)