SGN Marker C2_At1g60200

SGN-M3919
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309095 (SGN)
130754 (CGN)
---
Lycopersicon CombinedSingleSGN-U228043---
ArabidopsisSingleAt1g60200 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38216)
Chromosome
5
Position
7.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39489
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
Accessions and product sizes
Solanum pennellii TA56
850
Solanum lycopersicum TA209
850
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300
Solanum pennellii TA56
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25318)
Chromosome
1
Position
22.21 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10305
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10306
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12209
Forward primer (5'-3')
TCATGACAGATCCAGCCAGAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTCAGAACAAACATTTCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12210
Forward primer (5'-3')
TCATGACAGATCCAGCCAGAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTCAGAACAAACATTTCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12211
Forward primer (5'-3')
TCATGACAGATCCAGCCAGAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTCAGAACAAACATTTCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12212
Forward primer (5'-3')
TCATGACAGATCCAGCCAGAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTCAGAACAAACATTTCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12213
Forward primer (5'-3')
TCATGACAGATCCAGCCAGAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTCAGAACAAACATTTCAGCTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 12214
Forward primer (5'-3')
TCATGACAGATCCAGCCAGAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTCAGAACAAACATTTCAGCTTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12728
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12729
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12730
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32602
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32807
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32808
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 33324
Forward primer (5'-3')
TCATGACAGATCCAGCCAGAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTTCAGAACAAACATTTCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 10307
Forward primer (5'-3')
TTCTCTTATGAGATAAACTGGGC
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 300
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGCCTCTCCAGCATCTCAGTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g60200 was used as an overgo probe on plate 12 [well E12]

Plausible BAC Matches:   P215K16,   P156O15,   P261K11,   P224M24

 Non-Plausible BAC matches

P316H03,   P018E12,   P017C23

 Overgo Sequences

A sequence
GACGAACATATGGTCCAACCTTCC
B sequence
GCGATGCTACAGAGATGGAAGGTT
AB sequence
GACGAACATATGGTCCAACCTTCCATCTCT
Marker sequence
NNNNNNNNNNNNNNNNNNNNGCCCCTACAAAAAGGTTAGAATTTGGCCTC
TCAGGGTCAGGAAAAAGAGCTGCTGTCCCTTCTTTCTTCAATGCGGATGA
GGATGAGGATACTCAAAAAGAAAAGAAAATGAGGCCATTGGTTCCAATTG
ACTACTCAGCTGACGAACATATGGTCCAACCTTCCATCTCTGTAGCATCG
CCGACTATGGCTGCAGAATTTGCAAAGCGAATTTCAAATGTCAATGCTAA
AGAAGAGAGGCCTGATATAGAGAAGGAGAGACACAGAAGAACTCATGACA
GATCCAGCCAGAGGGATCGGGACAGGCATGACGAGGAGACTAACCGAACC
AGGGATGACGGTAGAAACCTTGATCATGGCAGAGTTCGGGAAACTAGACC
TGATAAGGTTAAGACACCTGATAATCAGAAGCTTTTAGATGCAAAGCAAT
TGATTGACATGATTCCAAAGACCAAAGATGAGTTGTTCTCTTATGAGATA
AACTGGGCTACTTATGACAAGNNNNNAATGCATTACATGAAAGGATGAGA
CCGTGGATCAGTAAGAAGATCACTGATTTCCTTGGTGAGGAGGAGCCGAC
GCTGGTAGACTACATCGTCTCCAGCACTCAAGAACATGTCAAGGCAACTG
AGATGCTGGAGAGGCTCCAAAGTATATTAGATGAAGAAGCTGAAATGTTT
GTTCTGAAGATGTGGAGGATGCTTATATTTGAAATCAAGAAAGTTGAGAC
AGGTCTGGCTTTAAGGCCCAAATCCTAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g60200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3919 marker 3919
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)