SGN Marker Bs4

SGN-M3925
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the bacterial spot disease resistance protein 4 locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38045)
Chromosome
5
Position
22.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35565
Forward primer (5'-3')
GGAGCTGAATACGGATTGGA
Digested band sizes (using RsaI)
Solanum pennellii LA716: 400+500
Solanum lycopersicum LA925: 350+400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCGTTCCGATGATTTCTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1111
Solanum lycopersicum LA925: 1111
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
Bs4 was used as an overgo probe on plate 13 [well B1]

Plausible BAC Matches:   P271C01,   P003C20,   P238G19,   P027B05,   P212F01,   P239E14,   P315A06

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGGTGCAAAGATGGAGAACTGCCC
B sequence
TTTGCGGCAGCAGTTAGGGCAGTT
AB sequence
AGGTGCAAAGATGGAGAACTGCCCTAACTG
Marker sequence
ATACAATTTATTTTTAATCGAATCTATGGCATCTTCTTCTTCTTCTTCTG
CAAGTAATTCAAAGTATTATCCTCGATGGAAGTACGTTGTTTTTCTAAGT
TTCAGAGGTGAAGACACTCGAAAAACATTTACAGGTCACTTATACGAAGG
TTTGAGAAATAGAGGAATAAACACATTTCAAGATGATAAAAGACTAGAGC
ATGGAGATTCAATTCCAAAAGAACTCTTGAGAGCTATAGAAGATTCTCAA
GTTGCACTTATCATTTTCTCAAAGAATTATGCTACATCTAGGTGGTGCTT
GAATGAACTAGTGAAGATCATGGAATGCAAAGAGGAAGAAAATGGACAAA
CAGTCATACCGATCTTTTATAATGTGGATCCATCACATGTTCGATACCAA
ACTGAAAGCTTTGGAGCAGCATTTGCCAAACACGAATCAAAGTATAAGGA
TGATGTTGAGGGGATGCAGAAGGTGCAAAGATGGAGAACTGCCCTAACTG
CTGCCGCAAATCTAAAAGGATATGATATCCGTAACGGGTTAGTTGAATAC
ACATAATTACTTTTAATGTTTTTACTGTTAAAAAGGCATAGTCCAATCAA
TTTAATTAGAGAAGATACATAAAAGTCCAAAAAACTATTCAAGTTTTGCA
ACTTCCATACTTGAAAACTATAGAGTATTGTTATTACCTGAACTATTCTA
TTTCCTATTTAATACCCTGCTGATTATTAACAATATATATAGAGTATATG
AAATACTTGTTGGTATTTGACTTTCTTACATTGTCCACAATCAATTTTCT
TCTTTATGTAGGATTGAATCAGAGAATATTCAGCAGATCGTAGATTGCAT
CTCTTCCAAATTTTGTACGAATGCTTATTCTTTATCTTTTTTGCAAGATA
TTGTGGGAATAAATGCTCACTTAGAGAAACTAAAATCGAAACTTCAAATA
GAAATCAATGATGTTCGGATTTTAGGGATCTGGGGAATAGGCGGAGTCGG
TAAAACAAGAATAGCAAAAGCCATTTTTGATACTCTATCTTATCAATTTG
AAGCTTCTTGTTTTCTTGCTGATGTTAAAGAATTTGCAAAAAAGAATAAA
CTGCATTCTTTACAAAATATTCTTCTCTCTGAACTGTTAAGGAAAAAAAA
TGATTACGTCTACAACAAGTATGATGGAAAGTGTATGATTCCAAACAGAC
TTTGTTCTTTGAAGGTTCTAATTGTGCTTGATGATATAGATCATGGTGAT
CAGATGGAGTATTTAGCAGGTGATATTTGTTGGTTTGGTAATGGCAGCAG
AGTTATTGTAACAACTAGAAACAAACATTTGATAGAGAAAGATGATGCGA
TATACGAAGTGTCTACACTGCCTGATCATGAAGCTATGCAATTATTCAAT
ATGCATGCTTTTAAAAAAGAAGTTCCAAATGAGGATTTTAAGGAGTTGGC
GTTAGAGATAGTAAATCACGCTAAAGGCCTCCCTTTAGCCCTCAAGGTGT
GGGGCTGTTTATTGCATAAAAAAAATCTCTCTTTATGGAAAATAACAGTA
GAGCAAATAAAGAAAGACTCTAATTCAGAAATTGTTGAACAACTCAAAAT
AAGTTATGATGGGTTGGAGTCCGAAGAGCAGGAAATATTTTTAGATATAG
CATGTTTCTTCCGCGGAGAGAAAAGAAAAGAGGTCATGCAAATTCTTAAG
AGTTGTGACTTTGGAGCTGAATACGGATTGGATGTTCTGATTAATAAATC
TCTTGTGTTCATATCTGAAAATGACAGGATTGAAATGCATGATTTGATTA
GAGATATGGGTAGATATGTGGTGAAAATGCAAAAGCTTCAGAAAAAACGT
AGCAGAATATGGGATGTTGAAGATTTCAAAGAAGTGATGATAGACTATAC
GGTAAGTAAGCTTAACAATGCAATGATATTTAATTTCTAATTTTTATATT
CCAAGGAACTTATAGGCTAATCAATACAGTTTATGAATAATTGACTCATT
GATCTTTATACCAGGGGACCATGACAGTGGAAGCAATCTGGTTTAGTTGC
TTTGAAGAAGTACGTTTTAATAAGGAGGCAATGAAAAAAATGAAAAGGCT
TAGGATATTACACATATTTGATGGTTTTGTCAAATTCTTCTCTTCGCCTC
CCTCTTCCAATTCCAATGATTCAGAAGAAGAAGATGATTCCTACGACTTA
GTCGTAGATCACCATGATGACTCTATTGAGTACCTGTCCAATAACTTGCG
TTGGTTAGTCTGGAATCACTATTCTTGGAAGTCATTGCCAGAAAATTTTA
AACCAGAAAAGCTTGTTCATCTTGAACTCCGTTGGAGTTCGCTTCATTAT
TTATGGAAGAAAACAGAGGTAACATTATTATTTACTTTACTTACCCTCCT
CCAGGAGCTTCAACCCCTTTTGCTCTCTTATTTACTCGAACCCACAACCT
TTTGGGTTGGAAGTGAGGGTGCTCAACTCCCTCTTGTCATTTTTGGTCTG
ACACAAAGATCATTATTCTTTCTCTATTTTGAATAACAGCATTTGCCGTC
TCTACGAAAGCTAGATCTCAGCTTATCTAAAAGTCTGGTGCAAACACCAG
ATTTCACGGGGATGCCAAATTTGGAGTATTTGAATCTGGAGTACTGTAGT
AAGCTTGAAGAGGTTCACTATTCCCTAGCATATTGCGAAAAACTCATTGA
GTTAAATTTGAGTTGGTGTACAAAGCTTAGGAGATTTCCATATATTAACA
TGGAATCTCTTGAATCTCTGGATCTACAATATTGCTATGGTATAATGGTG
TTTCCAGAAATCATCGGAACGATGAAGCCGGAGTTAATGATTCTCTCAGC
AAACACTATGATAACTGAACTACCATCATCTCTTCAGTACCCAACTCATC
TCACAGAGCTAGATTTGAGTGGCATGGAAAACCTTGAAGCTCTTCCAAGC
AGCATTGTCAAGTTGAAAGATTTGGTGAAGCTAAATGTGTCGTACTGCTT
AACGCTTAAAAGCTTGCCTGAAGAGATTGGTGATTTAGAAAACTTGGAGG
AACTTGATGCTTCGCGTACTCTAATTTCACAGCCTCCATCTTCCATTGTC
CGCTTGAACAAGCTTAAATCCTTGAAGTTAATGAAACGAAACACATTAAC
AGATGATGTGTGCTTTGTGTTTCCTCCTGTGAATAACGGGTTACTCTCAT
TGGAAATTCTGGAGCTCGGTTCCTCCAATTTCGAAGATGGAAGAATTCCG
GAAGATATTGGATGTTTATCCTCTTTGAAAGAGTTACGTCTCGAGGGAGA
TAATTTCAATCATTTGCCTCAAAGCATAGCCCAACTTGGTGCACTTCGAT
TCTTATACATAAAAGATTGCAGGAGTCTTACAAGTCTGCCAGAATTTCCA
CCGCAATTAGATACAATATTTGCAGATTGGAGCAATGATTTGATCTGTAA
GTCACTGTTTCTAAATATCTCATCATTCCAACATAACATCTCTGCTTCAG
ATTCGTTGTCGTTAAGAGTGTTTACGAGTTTGGGGAGTAGTATCCCAATC
TGGTTCCACCATCAGGGAACAGATACAAGTGTTTCAGTCAATTTGCCTGA
AAACTGGTATGTATCAGATAACTTCTTGGGATTCGCTGTATGTTACTATG
GCAATTTAACTGAGAACACAGCTGAATTGATTATGAGTTCTGCAGGGATG
CCATGTATCACCTGGAAACTTTTGTTATCGAATCATTCAGAATGTACATA
TATTAGGATTCATTTTTTCTTGGTACCTTTTGCTGGCTTATGGGATACAT
CTAACGCCAATGGTAAAACACCAAATGACTATAAGCACATTATGTTATCT
TTTCCTCAAGAATTGAAGGAGTGTGGAGTTCGTTTGTTCTATGAAGATGA
ATCTGTGCTTGAGACCACCAATGATGAACTTACCATTGGGGTAAGGAGGA
TCAGATACGACGACGACGATAGTGAACATTATGAGGAGGCTGGTTGTTCC
TCTTCTAAGAAACAAAGATCATAATATAGGTATATAAACTTGTGATCACT
TGCTGTTTGTTATTAATAATTCATTTCGATGCTCTATGTGGTTGTTAAAT
ATCTCTCATGTTATGACAGGGAGCAGAGGCGGAGCCAGAATTTTCAATAA
GAGGGCTCAAAATCTGTAGAAATAGATAGCTGAAGGGGTTTGACATCTTA
CTATATATATACATATAAACTTATTTTAACCATGTATAAATAATATAATT
TTTCGTCGAATGGGGTTTGGATGAACCCCTTCTATGAAGGTACAATGAAG
CATCAATCAAAGTGTGAGACAGTGGAGGAACGTTCACATATAGCAAACAT
AAAAATCATATTTGTATGTTATAGTTATAGTTAGCATCATTGTAAATTTT
GTACAAATGTTTCAGTTCTTTATTAATTCATTTTGTACATTGTAAATTTG
TATAATAACATCTGTATTTGTATAATTATAAGTGTATATGATGAATATAT
ATGTATATATATACTTTTCTCTCG
Genomic location of Bs4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3925 marker 3925
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)