SGN Marker C2_At2g01110
SGN-M3927
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species
| Synonyms |
| Locus associations |
| Orthologs in this COSII group |
| Species | Copies | Sequence ID | CDS/Edited sequence | Peptide sequence | Predicted introns |
|---|---|---|---|---|---|
| Coffee | Single | 310764 (SGN) 125518 (CGN) | - | - | - |
| Capsicum annuum | Single | SGN-U202030 | - | - | - |
| Lycopersicon Combined | Single | SGN-U220240 | - | - | - |
| Solanum tuberosum | Single | SGN-U263209 | - | - | - |
| Arabidopsis | Single | At2g01110 on TAIR | - | - | - |
Mapped locations
|
| ![]() Tomato - Kazusa and SolCAP markers mapped to genome |
| ![]() Kazusa F2-2000 genetic map |
| ![]() Tobacco N. tomentosiformis |
| ![]() Pepper-COSII |
| ||||||||||||||
| ![]() Tomato-EXPEN 2000 |
| ||||||||||||||||||
| ![]() Arabidopsis COSII |
| Other PCR data |
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| Unigene blast matches for primers |
| Overgo hybridization and physical mapping |
C2_At2g01110 was used as an overgo probe on plate 13 [well C2]
Plausible BAC Matches: P251J14, P041C18, P309L13, P313F03, P006L06, P237P14, P081N16, P294K10, P237E15, P271P05, P244P17, P055G23, P282K01, P255M10
Overgo Sequences
|
A sequence
CTTTACTTGGGTGGAGCATGGATG
|
|
B sequence
GCCCAGAAAGCTTAACCATCCATG
|
|
AB sequence
CTTTACTTGGGTGGAGCATGGATGGTTAAG
|
|
Marker sequence
ATGGGAAGTTCAAGTGCTCTCATCTCAAATCTTCACCTGACTCAAACTAA
CTGTTTCAAATGCTTGAATTCAAGAACTTCTCTGAATATCAACCCCACAA GGCCAAAATTGAATCTTTCTAGCAGAAAATGCATCAAAAAGTTCAGCAGA CTTGTTTGTTCTGCTGTTGAAGATTCCATGGAGAAACAGAGAGAAATTAG TGGAGCAAATGCTAGCAGTCTTGGTTCAGCTGTTGAAGATAGACCTGATG TCGGTGATGGCTCAAGCAAGAGTTTATTTAAGAACGNNNNNGTGGATCAG ATAGTGAAGGGAATGTTGTTTATGATTTCCTTTACCCTAATAAAGAGCTG CTACCAGATGATAAAGAAATGACTCTATTTGATCATTTGGAGGAGTTGCG CCAGAGACTCTTTGTGTCTGTTTTGGCCGTTGGTGCTGCTATAGTGGGAT GTTTTGCCTTCTCAAAAGAACTTATCTTGATTCTTGAAGCCCCTGTTCTA GCACAAGGTGTTCGATTTTTGCAACTAGGTCCAGGAGAGTTCTTTTTCAC TACTTTAAAANNNNNGTCTCAGGATATAGTGGCCTTCTCTTAGGAGCTCC TGTGATTCTCTACGAGATCATAGCCTTCGTTCTTCCTGGTTTGACAATGT CAGAAAGAAGATTCCTGGCACCAATTGTCCTTGGATCCTCTGTTCTTTTC TATGCCGGCATTGTTTTCTCACACTTGGTCCTCACTCCAGCAGCCTTGAA TTTCTTTGTTAATTATGCAGAAGGGGCTGTGGAATCTTTTTGGTCCATTG ATCAATACTTCGAATTTGTGCTCGTACTCATGTTCAGTACAGGGTTGTCT TTCCAGNNNNNGTTCCTGTCATTCAACTGCTTCTGGGACAAACTGGTCTT GTGTCAGGAGATCAAATGCTGTCGATTTGGAGATACGTGGTGGTAGGTGC TGTCGTTGCTGCTGCAGTGCTCACACCATCAACTGATCCCCTTACTCAAA TGCTTCTAGCTGGCCCACTTTTAGGTCTTTACTTGGGTGGAGCATGGATG GTTAAGCTTTCTGGGCGATAA |
| Universal primers for Asterid species |
No additional PCR data found.
| Other COSII sequence data |
BLASTX result of original unigene sequences against Arabidopsis protein database
Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
BLASTX result of original unigene sequences against Arabidopsis protein database
Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Related Markers
|
Related Genotyped Markers: These markers have been genotyped and share a name with this marker
Genomic location of C2_At2g01110
|
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Mapped locations
Mapped locations






