SGN Marker TG131

SGN-M393

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3700
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG131 image not available
Forward sequence
CGGGGATCTCTAAGTCATTCAGGGTCAAGAGAGAACCCATCTCAACTTATTAGTTTCCAATAGAACAAGCTTTATAGACATGCTCAATTA
GAGAAATTAAGGCCAGCACAAGCACAACTATGGCCTAACGGTCAACGAAACTGGGCAGAAAAATTAGATGATGCTTTCCAGGTGGTGGAT
AGAGCTACCAAAACATGAACACCAGCGTTAAAATTTATTTTTTTTTTTTTAAAAAAAAAAAGTAGAATTTGCGTTTTTACTTCCCGCAGC
GTTTGCAGCAAAAAATTCTCCCTAAATTTGTAAAAAGCAACTCAACATTTCCAAAGTCCCATACGAAAAAATGGAGTGAATGCAAAGCAC
TAATCACATTTTCAAAGAAAAAGGAATCGAAAAATAAACAGAGAAAATGAAGAAGATCATACCAGCCCTCGTCCGAAGAATCATAGCCAG
AAGTAGACTGCCGAA
Reverse sequence
ATAACTTGCATTCTCATGTGATCCATTGCAGAGATTTCTATCTCCGTGTTCTGAAGTAGTTGCATCCTGACCCGACTTTCTGCAAGCATG
TACAATGCTCATTATGTCACCAGAAGTCCTGTCTTGAGGCAAATGCTCAATTAAGCCAACCTTGCGGTTCCAATTCAGAAGATGAATTCC
CAAGTACGAGGGCTCTAAATTTAGTAGTTTATGGACATCCACATCAACCGTATATACAAACTTCTGTTCCTTTTGCAACTGTAATGAGGT
TAATGTAGAAGTTAAGTACATCAACAACTGTACCTATTATATATTTTGTTTCAAGCAATTCAATGCTAAGGCTACATTATCACTAGTATC
ATCGTCCCTACAGTCCTACACTATAATCAAGGATACATCCATAATAAGCTCAATTACATGAGCATCCTAATATGGTAGAAATAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1723711.8e-3481 (18.2% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53869)
Chromosome
3
Position
8.80 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A

Titratable_acidity_ta3_1 Fruit_diameter_fd3_1 Elasticity_ela3_1 Fruit_weight_fw3_1 2_Phenylethanal_content_pea3_1 Carotene_content_car3_1 Sugar_content_suc3_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53172)
Chromosome
7
Position
31.56 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53173)
Chromosome
2
Position
80.34 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53174)
Chromosome
3
Position
34.48 cM
Confidence
uncalculated
Protocol
unknown
Subscript
C

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39901)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9046)
Chromosome
7
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9045)
Chromosome
2
Position
73.40 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9052)
Chromosome
7
Position
51.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9050)
Chromosome
2
Position
26.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9051)
Chromosome
3
Position
2.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
C


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG131 was used as an overgo probe on plate 1 [well G1]

Plausible BAC Matches:   P317E07,   P149H16,   P039N13,   P174H02,   P275J20,   P017N03,   P152B06,   P039B16,   P148K11,   P099L22,   P186H10,   P180A22,   P101F21,   P148H20,   P043O21,   P028E03,   P175G03,   P274I23,   P095C08

 Non-Plausible BAC matches

P296M01,   P299K19,   P163M15,   P098C19,   P167D12,   P290I04,   P289C16,   P296I22,   P108F01,   P161D15,   P027H15,   P137A03,   P149M17,   P162B16,   P137C03,   P298G06,   P304N17,   P147E11,   P176J15,   P161D16,   P289J20

 Overgo Sequences

A sequence
AAGCACAACTATGGCCTAACGGTC
B sequence
TCTGCCCAGTTTCGTTGACCGTTA
AB sequence
AAGCACAACTATGGCCTAACGGTCAACGAA
Marker sequence
CGGGGATCTCTAAGTCATTCAGGGTCAAGAGAGAACCCATCTCAACTTAT
TAGTTTCCAATAGAACAAGCTTTATAGACATGCTCAATTAGAGAAATTAA
GGCCAGCACAAGCACAACTATGGCCTAACGGTCAACGAAACTGGGCAGAA
AAATTAGATGATGCTTTCCAGGTGGTGGATAGAGCTACCAAAACATGAAC
ACCAGCGTTAAAATTTATTTTTTTTTTTTTAAAAAAAAAAAGTAGAATTT
GCGTTTTTACTTCCCGCAGCGTTTGCAGCAAAAAATTCTCCCTAAATTTG
TAAAAAGCAACTCAACATTTCCAAAGTCCCATACGAAAAAATGGAGTGAA
TGCAAAGCACTAATCACATTTTCAAAGAAAAAGGAATCGAAAAATAAACA
GAGAAAATGAAGAAGATCATACCAGCCCTCGTCCGAAGAATCATAGCCAG
AAGTAGACTGCCGAA
Genomic location of TG131  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D393 marker 393
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)