SGN Marker CT109

SGN-M395

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTTTAAAAAAAATCAAAGATATCTTATTTACCCCGACCAAACTAAGGAAAATAAGTAACAAAAGCCGGCCGAATAAA
CAAAGTACCATTCAACAGTGCCCATTAAACATAGACAAACAAACAAAGAAGTTTACAAACACAAAATGAAAATTACGCAACGAGTTGATC
AAAATTGCACACTACTTAAAAATCTCCACTTGGGATTTGCT
Reverse sequence
ATCTTCATTAGCCACACTCATGAGCAAATCCCAAGTGGAGATTTTTAAGTAGTGCTGAATTTTTATCAACTCGGTGTTTAATTTTCGTTT
TCTCTTTGTAAACTTCTTTGTTTGTTTGTCTATGTTTAATGGGCACTGGTGAATTGTACTTTGTTTATTCGGACGGCTTTTGCTATTTAT
TTTCTTTATTTTGATCGTGGCAAATAAAATATTTTGATTTGTTTTAAAAAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1438031.2e-61190 (86.0% of RFLP seq)+
SGN-U1438036e-104225 (93.4% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51859)
Chromosome
2
Position
46.94 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42293)
Chromosome
6
Position
105.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38960)
Chromosome
6
Position
75.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 9062)
Chromosome
6
Position
122.41 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9057)
Chromosome
6
Position
87.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9059)
Chromosome
6
Position
113.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9058)
Chromosome
6
Position
67.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT109 was used as an overgo probe on plate 4 [well C6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGCCGGCCGAATAAACAAAGTAC
B sequence
TGGGCACTGTTGAATGGTACTTTG
AB sequence
AAGCCGGCCGAATAAACAAAGTACCATTCA
Marker sequence
CTTTTTTTTTTTTTTTTAAAAAAAATCAAAGATATCTTATTTACCCCGAC
CAAACTAAGGAAAATAAGTAACAAAAGCCGGCCGAATAAACAAAGTACCA
TTCAACAGTGCCCATTAAACATAGACAAACAAACAAAGAAGTTTACAAAC
ACAAAATGAAAATTACGCAACGAGTTGATCAAAATTGCACACTACTTAAA
AATCTCCACTTGGGATTTGCT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT109  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D395 marker 395
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)