SGN Marker U217233

SGN-M3955

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U217233
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40208)
Chromosome
6
Position
38.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14045
Forward primer (5'-3')
AGGCATAGCAATTCTATGGATGGG
Digested band sizes (using DraI)
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1400
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTGGAACGTGCAGCAGATTGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 1400
Approximate temperature
50°C
  
PCR data   Exp. ID 14045
Forward primer (5'-3')
AGGCATAGCAATTCTATGGATGGG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 1400
Solanum pennellii LA716: 1000
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTGGAACGTGCAGCAGATTGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Solanum pennellii LA716: 1400
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U217233 was used as an overgo probe on plate 13 [well A8]

Plausible BAC Matches:   P030O21,   P186B04

 Overgo Sequences

A sequence
CGTTACACTAGTGAGCTAGAGAGG
B sequence
GCAGAGTCTGCACTTTCCTCTCTA
AB sequence
CGTTACACTAGTGAGCTAGAGAGGAAAGTG
Marker sequence
ATGGACGCTAAGTTCGCCGGAAAGCCCATTCAGGCCCAATTTTATTCCGG
TCAAACTAACCTCGAACAGATGCAGGATACTCCAACCCGCGGGGCACGCC
ACCGCCGTGCACAATCCGAAACCTTTTTCCGTTTTCCCAGTTTTGATGAT
GATATGCTTTTAGACGATGTCGTTTCTGACTTCAGTCTCGATGTTCAGGC
TCCGACCCTCATGCAGCCGGCTAATTCGCCTGATTCTTCGTCTACTGGAC
CAGCGTTGTCGGCTGGACCTTCCGATTACCCTAAGCCGCTGGCTCACTAC
CGTAGTCTATCTGTTGATGCTGATTTTTTCGATGGACTGGATTTTGGTGG
TGTGCCGACGGAGAAGAAACTGATGGGTTCTGAGCCACGTCATAGGCATA
GCAATTCTATGGATGGGTCTTTTGATACGTCGTCGTTTGAGTCTGAATCG
ATTTCTGTTAAGAAGGCTATGGCTCCTGATAGGCTTGCTGAGCTGTCCTT
GATTGATCCCAAAAGAGCTAAAAGNNNNNGATCCTAGCAAACAGACAATC
TGCTGCACGTTCCAAGGAGCGAAAAACTCGTTACACTAGTGAGCTAGAGA
GGAAAGTGCAGACTCTGCAGACTGAAGCCACCACTCTATCCGCTCAGATC
ACAGTTCTACAGNNNNNAGAGACACTTCTGGACTAAATGCTGAAAACAAA
GAACTGAAATTTCGGTTGCAAGCTTTGGAACAACAAGCACACCTTAGAGA
TGNNNNNCTCTAAATGATACGTTGAGGGAAGAACTGCAGCGGCTTAAGAT
TGAAGCAGGCCAACTTCCATCTGCAAATGGAAAC
Genomic location of U217233  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3955 marker 3955
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)