SGN Marker C2_At1g52200

SGN-M3961
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303316 (SGN)
119977 (CGN)
---
Lycopersicon CombinedSingleSGN-U221468---
Solanum tuberosumSingleSGN-U248104---
ArabidopsisSingleAt1g52200 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49215)
Chromosome
6
Position
38.23 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47146)
Chromosome
6
Position
46.16 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38196)
Chromosome
6
Position
44.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39474
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
200
Approximate temperature
55°C
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25260)
Chromosome
1
Position
19.45 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10254
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10255
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12671
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12672
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12673
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12674
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12675
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12676
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12677
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12678
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12679
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12680
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12681
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32599
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32784
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32785
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32786
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32787
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32788
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10256
Forward primer (5'-3')
ACATTTGGACAAATAGCAGAAGTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 200
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGAGAGCAGACAGCAGGCATCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g52200 was used as an overgo probe on plate 12 [well G9]

Plausible BAC Matches:   P102H03,   P009O14

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACATGCTGATGATGCCTGCTGTCT
B sequence
ATGATCCACTGAGAGCAGACAGCA
AB sequence
ACATGCTGATGATGCCTGCTGTCTGCTCTC
Marker sequence
ATGGGAAGAGTTGAAGCAAACAATGAAGGAGAAACATCTCAGGCAGAGAG
TGGTACTGAACCAGCTGCCTCACAGCCTCAACAGTTCCAAGGAGTACAAA
GTGTGTATCAGTCACCATCACACTTAACAATTGGAGCTCCTTGGAGTACT
GGCTTATTTGATTGTCATCTGGACCAAACTAATGNNNNNCTGTCATGACG
GCGTTCTTACCTTGTGTAACATTTGGACAAATAGCAGAAGTCCTTGATGC
AGGACAAATGANNNNNCATGCCCTTTGGGGACTTTCATATACATGCTGAT
GATGCCTGCTGTCTGCTCTCAGTGGATCATGGGCTCAAAATATAGAACCC
AATTGAGACAAAGATATAATCTAGTGGAAGCTCCTTATTCAGACATGATT
TCCCATATGTTCTGTCCATGTTGCTCTCTTTGTCAAGAATTCAGAGAGCT
TCGAAACAGGGGACTTGATCCCGCTCTAGGGNNNNNTGGAATGGTATAGT
TGCTCAGCGACACTATGGGAACCAACAAGTGAATCAAGCTCCTCAAGTAC
AATCCATGTCAATGTAAAAATTCAAGATTGTGATTCTTTATTTGTTTGAT
TTGAGGTTGTGGTGTGTTAGTAAAAACCAGATTCTGTTCATGTTTGAAGT
TGTATCCTTAAAACTCAACCATATTGTTGGCTGTGTTAGTTGTTTGAACT
ATGTTTTTACAACCCCAATTCGAGTTAGATTATAAAAAAAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g52200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3961 marker 3961
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)