SGN Marker C2_At1g22850

SGN-M3963
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308131 (SGN)
127273 (CGN)
---
Lycopersicon CombinedMultipleSGN-U221644---
Solanum tuberosumSingleSGN-U253558---
ArabidopsisSingleAt1g22850 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38130)
Chromosome
6
Position
46.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39418
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
Accessions and product sizes
Solanum lycopersicum TA209
200
Solanum pennellii TA56
200
Approximate temperature
55°C
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
100
Solanum pennellii TA56
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25090)
Chromosome
1
Position
8.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10080
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10081
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10082
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12504
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 220+400
Approximate temperature
55°C
  
PCR data   Exp. ID 12505
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12506
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12507
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12508
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12509
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12510
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12511
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12512
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12513
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32595
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32724
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32725
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32726
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32727
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32728
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 10083
Forward primer (5'-3')
ATCATTGTTTCCATTGGTGGAACG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 100
Solanum pennellii LA716: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGAAATTTCTTGTTCCCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g22850 was used as an overgo probe on plate 13 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATACCTGCCATTCCGTTGACCATG
B sequence
ATAGAAGACCAGCCGACATGGTCA
AB sequence
ATACCTGCCATTCCGTTGACCATGTCGGCT
Marker sequence
NNNNNGGACTAGAANNNNNATCCTTGCAATACCTGCCATTCCGTTGACCA
TGTCGGCTGGTCTTCTATTTGGCACTGTCACTGGGACCATCATTGTTTCC
ATTGGTGGAACGNNNNNGTGGCGGCAAGTGTTGCATTCTTGATTGCCAGA
TATTTTGCTCGGGAACGTATTCTTAAGTTGGTCGAAGGGAACAAGAAATT
TCTTGCAATAGACAAAGCAATTGGAGAAAATGGTTTCAAAGTTGTGACTC
TTCTCCGTTTGAGCCCCTTGCTTCCATTTTCTCTCGGGAATTACCTTTAT
GGTCTTACTTCAGTCGAGTTTGTACCATATGTACTAGGAAGNNNNNTTGG
CTAGGAATGCTTCCTGGATCATGGGCGTATGTGAGTGCAGGTGCATTTGG
CCGTGCAATTCTTNNNNNCAAGAAGGATCTGAAATTGGCCTAGGAGGAAA
CCAGCTATTGACCCTTGGAGTTGGTTTATTGTTTACAGCACTTGCTGCAA
CTTATGTAACACGGCTCGCTAAGNNNNNGACGCTGTAAAAGATATTGAGT
GA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g22850  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3963 marker 3963
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)