SGN Marker C2_At2g42810

SGN-M4003
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304455 (SGN)
122559 (CGN)
---
Lycopersicon CombinedSingleSGN-U222683---
Solanum tuberosumSingleSGN-U245480---
ArabidopsisSingleAt2g42810 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38388)
Chromosome
7
Position
45.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39637
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
Accessions and product sizes
Solanum lycopersicum TA209
1200
Solanum pennellii TA56
1200
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
520+560
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25924)
Chromosome
2
Position
17.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10852
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10853
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10854
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13089
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13090
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 600+700
Approximate temperature
55°C
  
PCR data   Exp. ID 13091
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13092
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13093
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13094
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13095
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13096
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13097
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13098
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 32624
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32969
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32970
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32971
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32972
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10855
Forward primer (5'-3')
TTGCCTTCAAGTGCATGTGTCC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 520+560
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGAGCTTCACGCCATCAACAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At2g42810 was used as an overgo probe on plate 12 [well F12]

Plausible BAC Matches:   P023C09,   P302I05,   P214H12

 Overgo Sequences

A sequence
CACACAAGCGATTGAGTTGAACGG
B sequence
GTACACCGCATTCTCACCGTTCAA
AB sequence
CACACAAGCGATTGAGTTGAACGGTGAGAA
Marker sequence
ATGCCCGGTATGGAAGCTGAGAACTCAAACGCCTCCCGAGCTGAAGAACT
CAAGCAACTCGCAAATGAAGCATTCAAAGGGNNNNNCATAAGTATTCGCA
AGCTATTGATCTGTACACACAAGCGATTGAGTTGAACGGTGAGAATGCGG
TGTACTATGCTAACCGTGCGTTTGCTCACTCCAAATTGGAGGAATATGGA
AGCGCAATACAGGATGGAACTAGAGCTATTGAAATTGACCCTAGATATTC
AAAGGNNNNNGTTATTATAGGAGAGGAGCTGCATATTTGGCAATGGGGAA
GTTCAAAGATGCACTCAAGGATTTTCAACAGGTNNNNNCAAGAAATTATG
TCCAAACGACCCAGATGCTACCAAAAAATTGAAGGAATGTGAGAAAGCTG
TCATGAAGCTAAAATTTGAAGAAGCTATTTCTGTCCCAGAATCTCAGAGG
CGTTCAGTAGCTGACTCTATTGATTATCGTTCTGTAGNNNNNAGGTGGAG
CCTCAATATGCTGGTGCAAGAATAGAGGGAGATGTTGTAACATTAGATTT
TGTGAAGAAGATGCTGGATGACTTCAAAAACCAGAAGAACTTGCATAAGA
GGTATGNNNNNCCTACCAAATAGTACTGCAAACAAGAGAAATGTTGCGAG
CACTGCCCTCCCTTGTTGACATTGTTGTTCCCGAAGGGAAGCACTTCACT
GTATGTGGTGATGTACATGGTCAGNNNNNTTTTATGACCTCCTAAATATT
TTCGAGCTCAATGGGCTTCCATCAGAAGACAATCCGTATCTGTTCAATGG
TGATTTTGTTGATAGAGGGTCTTTCTCTCTAGAGGTCATATTGACATTAT
TTGCCTTCAAGTGCATGTGTCCATCAGNNNNNCTATACACCTGGCGAGAG
GAAATCACGAAAGCAAGAGCATGAACAAAATATATGGGTTTGAGGGCGAG
GTCAGATCCAAGTTAAGTGAAATATTTGTGGAACTCTTTGCAGAAGTGTT
CTGTTGCTTACCTTTGGCCCATGTCATAAATGAGAAAGTCTTTGTAGTAC
ATGGAGGTCTTTTTAGTGTTGATGGCGTGAAGCTCTCTGATATTAGAGCA
ATTGATCGGTTTTGTGAGCCCCCAGAAGAGGGNNNNNGTTAATGTGTGAA
TTNNNNNNNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g42810  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4003 marker 4003
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)