SGN Marker TG139

SGN-M402

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3220
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG139 image not available
Forward sequence
GACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTT
CGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACAGGCATGGGTCCGTATCATCGGATTCGA
CAATGTTCGTCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCTAGAAAAACTAATTGCCCTATGTTTATA
GGGACAGTTTGTTT
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1555221.3e-0967 (23.6% of RFLP seq)+
SGN-U1637732.1e-1134 (12.0% of RFLP seq)+
SGN-U1682768.6e-14162 (57.0% of RFLP seq)+
SGN-U1555632.4e-2053 (18.7% of RFLP seq)+
SGN-U1637439.6e-2353 (18.7% of RFLP seq)+
SGN-U1637734e-2565 (22.9% of RFLP seq)+
SGN-U1637756.4e-27108 (38.0% of RFLP seq)+
SGN-U1555131.6e-27121 (42.6% of RFLP seq)+
SGN-U1637816.7e-30137 (48.2% of RFLP seq)+
SGN-U1637446.7e-30109 (38.4% of RFLP seq)+
SGN-U1637426.9e-33186 (65.5% of RFLP seq)+
SGN-U1555811.9e-39153 (53.9% of RFLP seq)+
SGN-U1555801.9e-39229 (80.6% of RFLP seq)+
SGN-U1555642.1e-4896 (33.8% of RFLP seq)+
SGN-U1637802.4e-57207 (72.9% of RFLP seq)+
SGN-U1555456.2e-61229 (80.6% of RFLP seq)+
SGN-U1637696.2e-61197 (69.4% of RFLP seq)+
SGN-U1555446.2e-61213 (75.0% of RFLP seq)+
SGN-U1555502.5e-63241 (84.9% of RFLP seq)+
SGN-U1556066.4e-64238 (83.8% of RFLP seq)+
SGN-U1555176.4e-64238 (83.8% of RFLP seq)+
SGN-U1555166.4e-64238 (83.8% of RFLP seq)+
SGN-U1555373e-75241 (84.9% of RFLP seq)+
SGN-U1555473e-75241 (84.9% of RFLP seq)+
SGN-U1555491.9e-76147 (51.8% of RFLP seq)+
SGN-U1555313.1e-78162 (57.0% of RFLP seq)+
SGN-U1637858.4e-85238 (83.8% of RFLP seq)+
SGN-U1555425.6e-89172 (60.6% of RFLP seq)+
SGN-U1555703e-109234 (82.4% of RFLP seq)+
SGN-U1555511e-120221 (77.8% of RFLP seq)+
SGN-U1555322e-128230 (81.0% of RFLP seq)+
SGN-U1555382e-128238 (83.8% of RFLP seq)+
SGN-U1555614e-133238 (83.8% of RFLP seq)+
SGN-U1555341e-160284 (100.0% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39903)
Chromosome
2
Position
53.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9072)
Chromosome
2
Position
47.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG139 was used as an overgo probe on plate 16 [well C8]

Plausible BAC Matches:   P036J03,   P108F10,   P140G21,   P151K04,   P172F09,   P259F08,   P071F03,   P270D08,   P010K15,   P186H19,   P258J18,   P018F22,   P230N09,   P123N11,   P144A20,   P112G16,   P191O07,   P298E04,   P068M21,   P092O06,   P041F03,   P071A05,   P139G01,   P172C11,   P228I15,   P272D13,   P032C06,   P112H17,   P235A13,   P126E23,   P159F21

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTACCGTGAGAACCATAAGTCACC
B sequence
GCCATCGTAGTATCCTGGTGACTT
AB sequence
GTACCGTGAGAACCATAAGTCACCAGGATA
Marker sequence
GACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACT
ACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGCACT
GATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCC
ACAGGCATGGGTCCGTATCATCGGATTCGACAATGTTCGTCAAGTGCAGT
GCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCTAGAAAAA
CTAATTGCCCTATGTTTATAGGGACAGTTTGTTT
Genomic location of TG139  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D402 marker 402
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)