SGN Marker CD64

SGN-M404

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGCAGGGGGGGGGGGGGGGGGGGTGTAAATAGGAAAGAGCTTTACGTACACAGCAGTATTAATATTGCTGCTGCGGTGGCCATTAACGGT
GGGTTGATAACACCGGTGCTTCAGGATGCTGACAAGTTGGATCTGTATCTGTTGTCTCAAAAGTGGAAGGAACTG
Reverse sequence
GGGGGGGGGTCGNNAATTTTTTAGTGCAACACATATATCACTTGCAATGCGGTACCAGCTAATCTTAGCTCTCCATCTACATTGTCAAGC
TATCTGGATTCTCAATAATCTTGGAAAAAGTTTGAAGGAAGGCTGCTAAGTCCGCGCCATACACAACTCGGTGATCTGCTGTGAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1729852.9e-80161 (92.0% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53743)
Chromosome
2
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51734)
Chromosome
5
Position
14.67 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49313)
Chromosome
5
Position
3.74 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47252)
Chromosome
5
Position
48.47 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42285)
Chromosome
10
Position
23.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38944)
Chromosome
5
Position
40.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9080)
Chromosome
5
Position
52.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9082)
Chromosome
10
Position
16.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9081)
Chromosome
5
Position
26.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9086)
Chromosome
5
Position
2.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD64 was used as an overgo probe on plate 5 [well D11]

Plausible BAC Matches:   P299O23,   P074L22

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ATATTGCTGCTGCGGTGGCCATTA
B sequence
GTTATCAACCCACCGTTAATGGCC
AB sequence
ATATTGCTGCTGCGGTGGCCATTAACGGTG
Marker sequence
TGCAGGGGGGGGGGGGGGGGGGGTGTAAATAGGAAAGAGCTTTACGTACA
CAGCAGTATTAATATTGCTGCTGCGGTGGCCATTAACGGTGGGTTGATAA
CACCGGTGCTTCAGGATGCTGACAAGTTGGATCTGTATCTGTTGTCTCAA
AAGTGGAAGGAACTG
Genomic location of CD64  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D404 marker 404
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)