SGN Marker t

SGN-M4076
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the carotenoid isomerase locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40542)
Chromosome
10
Position
61.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35671
Forward primer (5'-3')
CCTTAGGCCGTGTTGTGTTT
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCGTCAGAAAGCTTCACTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 871
Solanum pennellii LA716: 871
Approximate temperature
60°C
  
Genomic location of t  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4076 marker 4076
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)