SGN Marker TG50

SGN-M408

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53344)
Chromosome
2
Position
89.48 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9095)
Chromosome
12
Position
42.60 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9093)
Chromosome
2
Position
114.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9094)
Chromosome
3
Position
55.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
C


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9096)
Chromosome
2
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG50 was used as an overgo probe on plate 5 [well D4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P261G04,   P213G05,   P171H10,   P143B18,   P028B22,   P311A23,   P146A12,   P130K12,   P013C13,   P059P13,   P103I15,   P240P04,   P199P04,   P226M05,   P147C11

 Overgo Sequences

A sequence
CGTCTAAATGGCATGCACTGGTAC
B sequence
AAGTGAGCGCTCCAAAGTACCAGT
AB sequence
CGTCTAAATGGCATGCACTGGTACTTTGGA
Marker sequence
GTCGACCTGCGCAGGCTTCACATACCACACGATACAAGAAAAACAGAGAA
GTCTATGCGAATAGGAAGCCTGCATAATTACTGCCATTGGGCAAGTTATT
TGGTATTATTTTGACTTTTCAGGAGTAATGGAACATGTGTCGACCTTTTT
CATGTTTCTTGGTGAGCTTTTACTATCAATTTAAGTAGTAAAAGTACCAT
GAGAATGGAGAGTGACAACATAGATGATCACAGTATTCGTTCTGAACGTC
TAAATGGCATGCACTGGTACTTTGGAGCGCTCACTTAGGCTCAGTAAATC
AGGGAATATTTATATCAGGCATGTTGAATGAATCTTCCTTCACCTGCGCA
ATTGCCTAAAGAATTTCCTTTATAACATTTGACTCTTGACAGAACCTACA
GGCAAACATAAGAAAAAACAAACTCCAACTTTTCAGACATAAAGATCCTT
ATTCATGTTGAGTAAATTGAAGCTTGTAACTTAAATATTTTAGGTCTTCA
ATTGGAATAATATCCTTTGGGCAGAGATCAGGTGTGAAGTTGTAATT
Genomic location of TG50  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D408 marker 408
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)