SGN Marker TG51

SGN-M409

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TCTGAAGGCTAATGTAAGACGTGAAGATTATGAATATGAGGGGAAATTAAAATTATTTTATACTTTTAAATATTTTTTTGGCAATGAAGT
GCCGACAATTAAGAATTTTTTGTATCTTTCTTCCAATAAATATTTTAAAGAGAATTATAAAAGAAAAAAAAGATAAAAGTATTAAAATTT
TAAATATAAATTCCACCCGGACAAGTTGACACTCCACTTCTGCCTTGCCGGCCAGTACTCCTACCATATATATAAATATCCTAGATAATT
TTGCTTGCGCCTAATATTCATGAAATTATCTGCTGTATATTTCACTCATAAAGAAGCCTTATATATTATATTAGTCTAGCTTATCGATAA
TATATGTCTACCAGTTTTTGCTATTTGAAATTGCATCATATTGTTATAACAATT
Reverse sequence
AAAAAAGAGATTAAAGTAATTACTGTAAAAATACAAATAAAAATCAATCTTCGTAATTGATATTAAATTTTGAAGGCTAATGTAAGACAT
GAAGATTATGAATATTAGTGTTAATTAAAATTATTTTATACTTTTAAATATTTTTTTGGCAATGAATGCAGACAATTAAGAATTTTTTGT
ATTTTTCTTCCAATAAATATTTTAAAGAGAATTATAAAAGAAAAAAAAGATAAAAGTATTAAAATTTTAAATATAAATTTTAGCCGGAGA
AGTTGACACTCCACTTCTGCCTTGCCGGCAAGTACGCAGACAATATATATAAATATACTAGATAATTTTGTTTGTGCCTAATATTTATGT
TATTATTTGTTGTATATTTCACTCATAAAGAAGTCTTATATATTATATTAATCTAGCTTATTGTTAATATATTTTTACCAGTTTTTGCTA
TTTGAAATTGCATCATATTGTTATAACAATTTTGAACATAATAAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43019)
Chromosome
1
Position
11.20 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44019
Forward primer (5'-3')
GGCTATGAAATCGGTGAGTCAG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TGAAGGCTAATGTAAGACATGAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9097)
Chromosome
1
Position
22.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG51 was used as an overgo probe on plate 14 [well B5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAAATTCCACCCGGACAAGTTGAC
B sequence
AAGGCAGAAGTGGAGTGTCAACTT
AB sequence
TAAATTCCACCCGGACAAGTTGACACTCCA
Marker sequence
TCTGAAGGCTAATGTAAGACGTGAAGATTATGAATATGAGGGGAAATTAA
AATTATTTTATACTTTTAAATATTTTTTTGGCAATGAAGTGCCGACAATT
AAGAATTTTTTGTATCTTTCTTCCAATAAATATTTTAAAGAGAATTATAA
AAGAAAAAAAAGATAAAAGTATTAAAATTTTAAATATAAATTCCACCCGG
ACAAGTTGACACTCCACTTCTGCCTTGCCGGCCAGTACTCCTACCATATA
TATAAATATCCTAGATAATTTTGCTTGCGCCTAATATTCATGAAATTATC
TGCTGTATATTTCACTCATAAAGAAGCCTTATATATTATATTAGTCTAGC
TTATCGATAATATATGTCTACCAGTTTTTGCTATTTGAAATTGCATCATA
TTGTTATAACAATT
Genomic location of TG51  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D409 marker 409
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)