SGN Marker C2_At5g19690

SGN-M4102
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309468 (SGN)
127910 (CGN)
---
Lycopersicon CombinedMultipleSGN-U222818---
Solanum tuberosumSingleSGN-U250368---
ArabidopsisSingleAt5g19690 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41521)
Chromosome
9
Position
93.10 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43497
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38805)
Chromosome
12
Position
27.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39939
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
Accessions and product sizes
Solanum lycopersicum TA209
1350
Solanum pennellii TA56
1350
Approximate temperature
55°C
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
770
Solanum pennellii TA56
1100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27227)
Chromosome
5
Position
6.66 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11757
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11758
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11759
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13745
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13746
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13747
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13748
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32655
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33217
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33218
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33219
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11760
Forward primer (5'-3')
AGAGAGGCTTATGCATGGTTGAGC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 770
Solanum pennellii LA716: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGTTTGATAGCCATAGTCCCACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI, HaeIII, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g19690 was used as an overgo probe on plate 13 [well H7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AACAGTTGGTACAGCCATGTCCTC
B sequence
GGCTGCTTTTTCAGGAGAGGACAT
AB sequence
AACAGTTGGTACAGCCATGTCCTCTCCTGA
Marker sequence
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGGANNNNNAAACAGGCTGATGCAGGGGATA
ATGGTGATGGGGTTACACAGAATGATGTGGTGAAATCTGATAGAAATGAA
GAACTCCCAAAGGAAAAAGCTTCGAGAAAAAAGAAGAAAGAAAAGGAGAA
TGTTGAAAAAGTTCCCATTGCTAATAAAAAAAGTGAGAAGAGGCTTTTGA
TGTTACCCATGGAGGCTTCTTTTGTTGCTATTCTATTACTTGTGTTGCTG
GGTGCCTTTTATGTGNNNNNGTTCATTGTGTCTGGGCAGCTGCGGAAGCT
TACTCAGCTCCTTCTATTGTACTAACATCACAATCGCATGATGGACTTCA
TGTTTTTGATGACTTCAGAGAGGCTTATGCATGGTTGAGCCACAATACTG
ATGTAGATGATAAANNNNNGTGGCATCATGGTGGGACTATGGCTATCAAA
CTACTGCTATGGCCAATCGCACTGTTATAGTTGATAATAACACCTGGAAC
AATACACATATTGCAACAGTTGGTACAGCCATGTCCTCTCCTGAAAAAGC
AGCCTGGGAGATCTTCAACTCTTTGGATGTAAAATATGTTCTTGTTGTCT
TTGGAGNNNNNGTCTTGTTGGGTATCCCAGTGATGATATCAATAAGTTCC
TCTGGATGGTTAGAATCGGTGGGGGTGTCTTCCCTCATATCAAGGAACCT
GATTATCTGNNNNNAGAGATGGCCAGTACCGGATTGACTCTATGGCTACT
CCAACCATGCTGAACTCCCTCATGTACAAACTGTCTTATTACAGNNNNNG
TTTGTGGAGACAGATGGCAAGGGGTACGATAGAGTAAGGCGGACTGAAAT
TGGANNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text

Genomic location of C2_At5g19690  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4102 marker 4102
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)