SGN Marker TG573

SGN-M411

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG573 image not available
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGTATACAAACCATCTAAAAACAATTCTTGGAATATATGCAGTGTTACATAATATTGCCCTTATGTTC
CATCTCTGATGCAGGATTGAAGAGCTGCACTGTGAATTACTTGAAGAGAAAATATTGACGGCTACTTTGCAGAGTGAGATGGACGGGGAA
GAGAGGTTGGATGAGGCTTTCAAGGAGGTACTTAGTTCTGATGCCCTCCCTGTGAATCCATATTCATAATTGTTACAGAGCTAAAATATA
TAACAAAATTCTTTCATCTATACATGTGTAACATTCCATTTATGCAATTTTTGGATCAAGGAAGCTCTCAAAGAAATAAGAAAGAAACTA
TGTATTATATTCCTTCGTTACTGATAAATATCCACCCTTGAAGATGTTGTTTTGTACAACAGGTTGTTCACAAGTTCTATGAGATCAGAC
AGCAGTCACTGGAGGATATTGAAGAAGATGTGTCCTGGGAAGACAAATGTGGGCGCCTCCTGCATGATTTGTCTGAAATGTGGACTTTCG
GCAATCCTGAGGAAACATC
Reverse sequence
TCCTTGAGCTTTTCGTCCACCATGTTCACAGCTGATTTAATATGAGAAAATCCCTCATCAAGTAAACTCGTGATATCAATTTTATGCTGA
GAATGATAGAGGCGAAATGCCGATATTTGAGCCCGCAGCTTCTCTTCTGAAAGAATCTGCATGTTTGTCCTTTCAGTAATTAATACAAAC
ACTGGTGCTTATATTCCATTTCAGAAAAACAAAATTCGTACTTTCTGTTTTTCCAGTGCGCGCACTTTTTTCTTCAAGTGATTTTCTATT
TCAAGACCCTGAAAACCAACACAATTTTTTTTAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1707981.4e-3270 (12.5% of RFLP seq)+
SGN-U1707981.2e-54107 (19.1% of RFLP seq)+
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50411)
Chromosome
1
Position
86.40 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48343)
Chromosome
1
Position
136.98 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40092)
Chromosome
1
Position
148.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9104)
Chromosome
1
Position
115.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG573 was used as an overgo probe on plate 5 [well D7]

Plausible BAC Matches:   P049H10,   P135J07,   P307M11,   P060H07,   P092H13,   P076F17,   P240N09,   P191B05

 Non-Plausible BAC matches

P071A18,   P034C12,   P254L12,   P061C06,   P107G18,   P076I21,   P264B09,   P312E01,   P019C11

 Overgo Sequences

A sequence
GCCCTTATGTTCCATCTCTGATGC
B sequence
GCAGCTCTTCAATCCTGCATCAGA
AB sequence
GCCCTTATGTTCCATCTCTGATGCAGGATT
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGTATACAAACCATCTAAAAACAATTCT
TGGAATATATGCAGTGTTACATAATATTGCCCTTATGTTCCATCTCTGAT
GCAGGATTGAAGAGCTGCACTGTGAATTACTTGAAGAGAAAATATTGACG
GCTACTTTGCAGAGTGAGATGGACGGGGAAGAGAGGTTGGATGAGGCTTT
CAAGGAGGTACTTAGTTCTGATGCCCTCCCTGTGAATCCATATTCATAAT
TGTTACAGAGCTAAAATATATAACAAAATTCTTTCATCTATACATGTGTA
ACATTCCATTTATGCAATTTTTGGATCAAGGAAGCTCTCAAAGAAATAAG
AAAGAAACTATGTATTATATTCCTTCGTTACTGATAAATATCCACCCTTG
AAGATGTTGTTTTGTACAACAGGTTGTTCACAAGTTCTATGAGATCAGAC
AGCAGTCACTGGAGGATATTGAAGAAGATGTGTCCTGGGAAGACAAATGT
GGGCGCCTCCTGCATGATTTGTCTGAAATGTGGACTTTCGGCAATCCTGA
GGAAACATC
Genomic location of TG573  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D411 marker 411
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)