SGN Marker TG56

SGN-M415

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TATTACAGTTTCACATCACTCCATCTCTCATTCGCTTTTTTATTTTTCTTGTTTGTTTTTTTAGGTTGAAAGAGGGGCGGAGGAAAACTT
AGGAGATGAAATGAAATAATCTTCACCAACAATTTTTATTCTTGTACATGGCATTCATCATTCAACATGCTTTGACAATTAATTGTTGTT
CAACTATTCGCCTATTTAAATATTTCTGAAGAAAACAGAAGTGAAGGCAGTAAGAGATGACTATATGCAATTTGCAGTATGTCCAACAAC
TACAAAGTTTTAGCAAATACTGGAAGCCCGAGACGAGATTTCCAAGCAATAATTACCTAAGGTAGATGTTTGGGTTCATCGACAAACAGA
TACAAATTGATTGCTTCTGTTACAACGTACATAAAAGAATTCAATTCCAAAGCTCTTTTTTATAACATTGAAGACTTCCCCTCTAACTGA
ACTTTCACCGGGTATGTTGTTGTTGTTGTATAACATTTAGCACTTATTCGATTTAATGTGTTAGATCGGACAATC
Reverse sequence
GCTGCAGAGAAGATATACAGTTTTACATCACTCCCTCTCTCATTCGCTTTTTTATTTTTCTTGTTTGTTTTTTTAGGTTGAAAGAGGGGC
GGAGGAAAACTTAGGAGATGAAATGAAATAATCTTCACCAACAATTTTTATTCTTGTACATGGCATTCATCATTCAACATGCTTTGACAA
TTAATTGTTGTTCAACTATTCGCCTATTTAAATATTTCTGAAGAAAACAGAAGTGAAGGCAGTAAGAGATGACTATATGCAATTTGCAGT
ATGTCCAACAACTACAAAGTTTTAGCAAATACTGGAAGCCCGAGACGAGATTTCCAAGCAATAATTACCTAAGGTAGATGTTTGGGTTCA
TCGACAAACAGATACAAATTGATTGCTTCTGTTACAACGTACATAAAAGAATTCAATTCCAAAGCTCTTTTTTATAACATTGAAGACTTC
CCCTCTAACTGAACTTTCACCGGGTATGTTGTTGTTGTTGTATAACATTTAGCACTTATTCGATTTAATGTGTTAGATCGGACAATCATG
GTACAAAATTTAGTATTGTGTAATCCAGT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53357)
Chromosome
1
Position
52.24 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53354)
Chromosome
3
Position
31.88 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9112)
Chromosome
3
Position
14.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9113)
Chromosome
3
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG56 was used as an overgo probe on plate 2 [well B10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GACTTCCCCTCTAACTGAACTTTC
B sequence
CAACAACATACCCGGTGAAAGTTC
AB sequence
GACTTCCCCTCTAACTGAACTTTCACCGGG
Marker sequence
TATTACAGTTTCACATCACTCCATCTCTCATTCGCTTTTTTATTTTTCTT
GTTTGTTTTTTTAGGTTGAAAGAGGGGCGGAGGAAAACTTAGGAGATGAA
ATGAAATAATCTTCACCAACAATTTTTATTCTTGTACATGGCATTCATCA
TTCAACATGCTTTGACAATTAATTGTTGTTCAACTATTCGCCTATTTAAA
TATTTCTGAAGAAAACAGAAGTGAAGGCAGTAAGAGATGACTATATGCAA
TTTGCAGTATGTCCAACAACTACAAAGTTTTAGCAAATACTGGAAGCCCG
AGACGAGATTTCCAAGCAATAATTACCTAAGGTAGATGTTTGGGTTCATC
GACAAACAGATACAAATTGATTGCTTCTGTTACAACGTACATAAAAGAAT
TCAATTCCAAAGCTCTTTTTTATAACATTGAAGACTTCCCCTCTAACTGA
ACTTTCACCGGGTATGTTGTTGTTGTTGTATAACATTTAGCACTTATTCG
ATTTAATGTGTTAGATCGGACAATC
Genomic location of TG56  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D415 marker 415
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)