Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker CT56

SGN-M420

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
200
Vector
pCR1000
Cutting Site
HindIII/EcoR1
Drug Resistance
KN
Image
CT56 image not available
Forward sequence
CTTTTTTTTTTTCTTTGCTAGCTTTGCTCTTGGTTGGCTCATCACCAATGGTGCTGGTCTTGCTTCTTACCCCATTGATACAGTAAGAAG
AAGAATGATGATGACATCTGGTGAGGCGGTGAAGTACAGGAGCTCGCTTGATGCATTCTCCCAGATTGTTAAGAATGAGGGTCCCAAATC
TCTGTTCAAGGGTGCTGGTGCTAACATCCTCCGAGCTGTTGCTGGTGCTGGTGTGTTGGCTGGATATGACAAGCTTCAGGTTCTTGTTTT
GGGAAAGAAATACGGATCTGGTGGTGCATAAGTCAGCCTCGTAACATCCTTTAGAATTTAGATGGTGATGAAAATCTTTTTGTTGTTACA
TTTGAGTATTCAGTTGGGGAGACATTTATCATTTTTCCTTTTGACTTTTTTTGTAATAATTCGAAAAATCTTAGAGTGGGTCAAAGTTTA
AAAACCCCACACTCGTTTCCCTTGTTGAAGGATTATTACTGTTTTGTTTGGGCGGA
Reverse sequence
TTTTTTTTTTTTTTTGATTTTATCAAAAGATTTCATTCAGAATCTGTAAGCTCTGCAATTGAAATAAGGTCCGCCCAAACAAAACAGTAA
TAATCCTTCAACAAGGGAAACGAGTGTGGGGTTTTTAAACTTTGACCCACTCTAAGATTTTTCGAATTATTACAAAAAAAGTCAAAAGGA
AAAATGATAAATGTCTCCCCAACTGAATACTCAAATGTAACAACAAAAAGATTTTCATCACCATCTAAATTCTAAAGGATGTTACGAGGC
TGACTTATGCACCACCAGATCCGTATTTCTTTCCCAAAACAAGAACCTGAAGCTTGTCATATCCAGCCAACACACCAGCACCAGCAACAG
CTCGGAGGATGTTAGCACCAGCACCCTTGAACAGAGATTTGGGACCCTCATTCTTAACAATCTGGGAGAATGCATCAAGCGAGCTCCTGT
ACTTCACCGCCTCACCAGATGTCATCATCATTCTTCTTCTTACTGTATCAATGGGGTAAGAAGCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1584172.3e-0650 (9.9% of RFLP seq)+
SGN-U1585647.5e-28186 (36.8% of RFLP seq)+
SGN-U1605076e-4794 (18.6% of RFLP seq)+
SGN-U1433946e-4794 (18.6% of RFLP seq)+
SGN-U1605071.7e-56118 (23.3% of RFLP seq)+
SGN-U143394379 (74.9% of RFLP seq)+
SGN-U1584172.3e-0650 (9.7% of RFLP seq)-
SGN-U1585647.4e-25173 (33.6% of RFLP seq)-
SGN-U1605072e-139289 (56.1% of RFLP seq)-
SGN-U143394500 (97.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39059)
Chromosome
1
Position
92.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9129)
Chromosome
1
Position
72.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT56 was used as an overgo probe on plate 3 [well D9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTTTGCTCTTGGTTGGCTCATCAC
B sequence
AAGACCAGCACCATTGGTGATGAG
AB sequence
CTTTGCTCTTGGTTGGCTCATCACCAATGG
Marker sequence
CTTTTTTTTTTTCTTTGCTAGCTTTGCTCTTGGTTGGCTCATCACCAATG
GTGCTGGTCTTGCTTCTTACCCCATTGATACAGTAAGAAGAAGAATGATG
ATGACATCTGGTGAGGCGGTGAAGTACAGGAGCTCGCTTGATGCATTCTC
CCAGATTGTTAAGAATGAGGGTCCCAAATCTCTGTTCAAGGGTGCTGGTG
CTAACATCCTCCGAGCTGTTGCTGGTGCTGGTGTGTTGGCTGGATATGAC
AAGCTTCAGGTTCTTGTTTTGGGAAAGAAATACGGATCTGGTGGTGCATA
AGTCAGCCTCGTAACATCCTTTAGAATTTAGATGGTGATGAAAATCTTTT
TGTTGTTACATTTGAGTATTCAGTTGGGGAGACATTTATCATTTTTCCTT
TTGACTTTTTTTGTAATAATTCGAAAAATCTTAGAGTGGGTCAAAGTTTA
AAAACCCCACACTCGTTTCCCTTGTTGAAGGATTATTACTGTTTTGTTTG
GGCGGA
Genomic location of CT56  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D420 marker 420
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)