SGN Marker CD76

SGN-M435

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD76 image not available
Forward sequence
GGGGGGGGGGGGTATCGAAACAGCCCACACAGTTGAGATAAGGCAAAGTCCAATTTGATCCCACATTAAAAAAAGTTTCATTGTTTGTCT
CTAAATTGCCTTAAACCGAAGCACACAGGAAAATCCAGAAGTGTTTTCATATTACATGCTCAGTGTCATTAGATAACAACCTGTTGTATC
GAAAGATGTTACCAAAACTTCAAAACTGTCATAATCTCATTCTTCCTGTTGCTTCCATGGCTGATATGGCATCCCAAGAACAAGAATTGT
GTCCATTAGCTTGACCTGATGATGTGGTTACTGCATGGATTTGCTTGCAATCCCAGTCGCAATCATCGAAAAAGCAAGAACCAAAAGGAT
CTTTCGAAGCCAGATGGTTATTAGCATGCTGTGTCTTGGGACTGGAACCCCCCCCCCCCCCCTGCAGGTCGACGGATCCCCGG
Reverse sequence
CTGCAGGGGGGGGGGGGGTATCGAAACAGCCCACACAGTTGAGATAAGGCAAAGTCCAATTTGATCCCACATTAAAAAAAGTTTCATTGT
TTGTCTCTAAATTGCCTTAAACCGAAGCACACAGGAAAATCCAGAAGTGTTTTCATATTACATGCTCAGTGTCATTAGATAACAACCTGT
TGTATCGAAAGATGTTACCAAAACTTCAAAACTGTCATAATCTCATTCTTCCTGTTGCTTCCATGGCTGATATGGCATCCCAAGAACAAG
AATTGTGTCCATTAGCTTGACCTGATGATGTGGTTACTGCATGGATTTGCTTGCAATCCCAGTCGCAATCATCGAAAAAGCAAGAACCAA
AAGGATCTTTCGAAGCCAGATGGTTATTAGCATGCTGTGTCTTGGGACTGGAACCCCCCCCCCCCCCCTGCAGGTCGACGGATCCCCGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U170034333 (75.2% of RFLP seq)+
SGN-U170034333 (74.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9165)
Chromosome
1
Position
29.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9166)
Chromosome
1
Position
12.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CD76 was used as an overgo probe on plate 5 [well C11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P053H05,   P273G08,   P152D01,   P272O24,   P094B04,   P311H11,   P125F09,   P034D09,   P017C15,   P237H24,   P075P08

 Overgo Sequences

A sequence
CTTCCTGTTGCTTCCATGGCTGAT
B sequence
GTTCTTGGGATGCCATATCAGCCA
AB sequence
CTTCCTGTTGCTTCCATGGCTGATATGGCA
Marker sequence
GGGGGGGGGGGGTATCGAAACAGCCCACACAGTTGAGATAAGGCAAAGTC
CAATTTGATCCCACATTAAAAAAAGTTTCATTGTTTGTCTCTAAATTGCC
TTAAACCGAAGCACACAGGAAAATCCAGAAGTGTTTTCATATTACATGCT
CAGTGTCATTAGATAACAACCTGTTGTATCGAAAGATGTTACCAAAACTT
CAAAACTGTCATAATCTCATTCTTCCTGTTGCTTCCATGGCTGATATGGC
ATCCCAAGAACAAGAATTGTGTCCATTAGCTTGACCTGATGATGTGGTTA
CTGCATGGATTTGCTTGCAATCCCAGTCGCAATCATCGAAAAAGCAAGAA
CCAAAAGGATCTTTCGAAGCCAGATGGTTATTAGCATGCTGTGTCTTGGG
ACTGGAACCCCCCCCCCCCCCCTGCAGGTCGACGGATCCCCGG
Genomic location of CD76  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D435 marker 435
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)