SGN Marker TG650

SGN-M437

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATTGAGGGAAGTAGGGACTCCTGATATTAGGGGTTTGAAGAAAAAGCCAGTTACTGTTGTTTATAAGGCTGAAGATAAGACTGGTTTCT
TAAAAAAACTGTCTTTGAAGTTCAAGGAGCCTGAGAATACTACATTGTTCATTCTAGACAAGTAAGATTTGAAAAGAATTGCTTGATTGT
ATTTTGATTTGATAATATGTAGGTATGTAGCTTAACTTGTTGAAATCTTAGCTGAAAGATGTAATTAAAAGTCAGTAGTAATTCAGTGAG
GATTGCTTGTGTTTTAACATAATTAGTGAGCTCACCATCTTACCAATTAGTCAGTCATAGGCCTCAATGTGTATATCTTGAACTTTCGGC
TATCTACTTGGATTTTGGGGTTTGGTTTAGCTCTATTAGTCTTTAGTCTATTAGGTGTTGCATCGAGGGTTTAGAGGAACAAAGTCAAAG
ATTAGTAGGCAAATTAAAAGTTTCTATAGATGTGGTTG
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1555821e-20127 (26.0% of RFLP seq)+
SGN-U1476291.9e-68151 (30.9% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40122)
Chromosome
1
Position
88.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9168)
Chromosome
1
Position
67.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG650 was used as an overgo probe on plate 5 [well E11]

Plausible BAC Matches:   P330O05,   P167O07,   P167N07,   P228G02

 Overgo Sequences

A sequence
TGAGCTCACCATCTTACCAATTAG
B sequence
TGAGGCCTATGACTGACTAATTGG
AB sequence
TGAGCTCACCATCTTACCAATTAGTCAGTC
Marker sequence
AATTGAGGGAAGTAGGGACTCCTGATATTAGGGGTTTGAAGAAAAAGCCA
GTTACTGTTGTTTATAAGGCTGAAGATAAGACTGGTTTCTTAAAAAAACT
GTCTTTGAAGTTCAAGGAGCCTGAGAATACTACATTGTTCATTCTAGACA
AGTAAGATTTGAAAAGAATTGCTTGATTGTATTTTGATTTGATAATATGT
AGGTATGTAGCTTAACTTGTTGAAATCTTAGCTGAAAGATGTAATTAAAA
GTCAGTAGTAATTCAGTGAGGATTGCTTGTGTTTTAACATAATTAGTGAG
CTCACCATCTTACCAATTAGTCAGTCATAGGCCTCAATGTGTATATCTTG
AACTTTCGGCTATCTACTTGGATTTTGGGGTTTGGTTTAGCTCTATTAGT
CTTTAGTCTATTAGGTGTTGCATCGAGGGTTTAGAGGAACAAAGTCAAAG
ATTAGTAGGCAAATTAAAAGTTTCTATAGATGTGGTTG
Genomic location of TG650  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D437 marker 437
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)