SGN Marker TG64

SGN-M444

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG64 image not available
Forward sequence
GTCCTGAAAAGTTATCAAGGATTCATCAGTAACCTGATTATATCAACTCGTTTAAATTTATTCATACTTAATAGATCAACCCCTATGATC
TCATTCTGACTATAAGCCTAAAGGTGAACAAGTGAGAAAAGGCCTAAATTATTTTTCTTCAAAATGTTGGTAATGTGATTACCTGATAAT
TTAGGCATCTTAGTGTACGTAAATGGCATGAATGGTGAAGGTGCTTGCAAAGGCAGCATAGCTTTGCTAGGAGTGATGTCTGGAGAGGCA
TGATTATGAGTTGTACTTAATAAATCACTCTCTTGAGATTTATGAATTCCTGAAACTGGAAAAAGGCTATGAGTGCATTTCATCAAGACA
ATTACGAATCAATTGAAATTGAAAATCACGTACAGAGAAGCAACACTATTGAGACTTGAATCATGAGACTCATTTCTTCAAATTTTGTTT
ACGTGTATAACCGAAAGATATATTTTGTGTGTAAATTGATTAAGCATAAGGTGTTT
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9183)
Chromosome
7
Position
46.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG64 was used as an overgo probe on plate 8 [well F12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTGCAAAGGCAGCATAGCTTTGC
B sequence
CCAGACATCACTCCTAGCAAAGCT
AB sequence
CTTGCAAAGGCAGCATAGCTTTGCTAGGAG
Marker sequence
GTCCTGAAAAGTTATCAAGGATTCATCAGTAACCTGATTATATCAACTCG
TTTAAATTTATTCATACTTAATAGATCAACCCCTATGATCTCATTCTGAC
TATAAGCCTAAAGGTGAACAAGTGAGAAAAGGCCTAAATTATTTTTCTTC
AAAATGTTGGTAATGTGATTACCTGATAATTTAGGCATCTTAGTGTACGT
AAATGGCATGAATGGTGAAGGTGCTTGCAAAGGCAGCATAGCTTTGCTAG
GAGTGATGTCTGGAGAGGCATGATTATGAGTTGTACTTAATAAATCACTC
TCTTGAGATTTATGAATTCCTGAAACTGGAAAAAGGCTATGAGTGCATTT
CATCAAGACAATTACGAATCAATTGAAATTGAAAATCACGTACAGAGAAG
CAACACTATTGAGACTTGAATCATGAGACTCATTTCTTCAAATTTTGTTT
ACGTGTATAACCGAAAGATATATTTTGTGTGTAAATTGATTAAGCATAAG
GTGTTT
Genomic location of TG64  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D444 marker 444
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)