SGN Marker CT120

SGN-M446

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAAATTGAAATATCAATACCATTATATTATCAAACTCTTATACAACAGCATATTCGCAA
ATAATCACTTTAGTTTCTTTCTTTTTCATCCTTATTGTTCTTTTGTTCTATGATTTGTTTACAAACAGTTTTGAGTTTGTAAACAGAAAA
CGACTAGTTCCATTTTTTTACAGAAAATTTCGAGGGGGCGAAGGATTCTTGAGTAAAATATGAATCCATTGATTACTTCCCCCATCATGC
GCGCACTCCCTTATAACAACCCCGTGTATGAAGGGAGGAAAACCAAACTCTCCAAGCTCACCTTAAAAGAACAATCAAACAGATGTCACA
AATGGCTAAACCTGCCACAACCAAATCACACTCCAGCTATTGAGGAAATATAGTATGGATCATCACTTGGTTGTATCGGGATCAAACTTA
AGAGCCTCGTTCCATATGAGCTCCTTAATGTCTTCCTCGCTTAGAGATGCTTGTTCAAA
Reverse sequence
TTTTTTTTTTTTTTATTTATAAATTAGTAACCACATTATATTCTTTAAATTAAATTGATACATTGAGCTACTACTTAGCATGAAGATTTA
AGGACAGAAGCAGTATCAACATTGTTGTTTATTGATTTTCTTAATAAAAAGTCAATTGAATTCCTTTTTTTTTTTTTTTTTTTTAAGACC
GTAAAATCTCAATAAAATTTATTTGTGAATGAAACGAAAGAAATACATTTCCAAAAAAAATTAGAAAATTACAATTCGTAAAGATAAATA
TTTTAATTTAATAATCAACGTAAATGAGTATGAAATATAGCTAAAAATATTTTTTTCTCTATAATTAAAAATAACAATTAATTATTATAT
ATTTCTACTCTGCCACCATGGATTCAATTACCACCTCAGCTTTGTTGGAAAATACTTTTCGATAAAAAAGAGATAGTATGGCTTGACTTT
TTCCACATCAATTCGAACTTTACTCTTGCTATATAAATCATATTTATTAAAAATGTTGAGC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1687648.8e-4090 (17.7% of RFLP seq)+
SGN-U1468671.1e-60139 (27.2% of RFLP seq)-
SGN-U1445855e-146325 (63.6% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53759)
Chromosome
12
Position
17.80 cM
Confidence
uncalculated
Protocol
RFLP

Pentanal_content_pna12_1 Fruit_weight_fw12_1 Titratable_acidity_ta12_1 Fruit_diameter_fd12_1 pH_pH12_1
Tomato QTL map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38968)
Chromosome
11
Position
99.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38969)
Chromosome
10
Position
0.00 cM
Confidence
I
Protocol
RFLP
Subscript
C


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9184)
Chromosome
11
Position
86.20 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9185)
Chromosome
12
Position
30.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT120 was used as an overgo probe on plate 15 [well B10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTAAACCTGCCACAACCAAATCAC
B sequence
CCTCAATAGCTGGAGTGTGATTTG
AB sequence
CTAAACCTGCCACAACCAAATCACACTCCA
Marker sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAAATTGAAATATCAATAC
CATTATATTATCAAACTCTTATACAACAGCATATTCGCAAATAATCACTT
TAGTTTCTTTCTTTTTCATCCTTATTGTTCTTTTGTTCTATGATTTGTTT
ACAAACAGTTTTGAGTTTGTAAACAGAAAACGACTAGTTCCATTTTTTTA
CAGAAAATTTCGAGGGGGCGAAGGATTCTTGAGTAAAATATGAATCCATT
GATTACTTCCCCCATCATGCGCGCACTCCCTTATAACAACCCCGTGTATG
AAGGGAGGAAAACCAAACTCTCCAAGCTCACCTTAAAAGAACAATCAAAC
AGATGTCACAAATGGCTAAACCTGCCACAACCAAATCACACTCCAGCTAT
TGAGGAAATATAGTATGGATCATCACTTGGTTGTATCGGGATCAAACTTA
AGAGCCTCGTTCCATATGAGCTCCTTAATGTCTTCCTCGCTTAGAGATGC
TTGTTCAAA
Genomic location of CT120  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D446 marker 446
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)