SGN Marker TG587

SGN-M447

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AGAAGCTGATAGTGAACACACCACAGTTACAGATAGTTATGAAAAGAAGTCTGGTGGTCGAGATATTGAGAACCGTATTGCACCAATCCA
GCAAAGAATTAGAGCTTTGAGACAGGAAATTGATGATCTTCTGGAAATAATTGATGAGATATAATTTCAGTGCAGACAACATTGATCCAA
TATAAATGGCTAAAATATTGTTGTGAGGTGAACAACAGAATTAGGATCAATTCGAGATATTAGTTGATGCAGCTGTATGTTGTTGAGAAC
CTGAATAACTTTGTAGGTGTAGAATTCTAGGTTCTTGCCGAATCTCTTTGGTTGACAATCAAATGAGTGCTGTAGACAACTGTTTTTTCA
TATATATTGAGTTGTTAAGTTTATGGTTTTCTAACGTAATTGAGCTCATAGATTATCAAATTCCGACTTGATATTGCAAGTGAGTGCAAT
ACCTTATCAATGATCATGATGTCAGCATACGCATTATATTAT
Reverse sequence
GCTTGCATGCCTGCAGAAGAAACAAGTCTCTATCGTGCAAAAACTTCAAGAAGAATAACTCAGTGATGCTCAAATCACTAGTCTTTTAAC
ATGAGTAAACAGTTAAACTAAATCATCTAGACATCATGAACCAGCAGAAAACATACCCAAAAACCCCACATGACATTTACAAAAGAAGTT
TCAGGGTGAGGGGTAATAATTGAGGTTGTGGAGAGGAAACAAGAGTATATCAAGCAAAAAATTCAAGAAGAACAACGAATGCTGAAAACC
GAGTCTCTTGGCATGGATAAATGCATAAAGCTCAAGTCTTGTCACAAAATTTCAAGGAAAGGGCAACTTATTAATGCTCAAAACTGAATC
TTTTGACATGGGCAAATTCTTACAGCTCAAGTCTTGTCACAAAATTTCATGGAAAGAGCAACTTATTAATGCTCAAAACTGAATATTTTG
ACATGGGAAATGCTTAAAACTCAAGTCTCCTCGCAAAATTTACAGAAAAGTGTAACTTAATAATGCTCAAAATTCAGTCTTTTGACATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U146142395 (80.3% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40102)
Chromosome
4
Position
134.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9192)
Chromosome
4
Position
124.40 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG587 was used as an overgo probe on plate 7 [well C2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P206I09,   P066I13,   P122J14,   P209H15,   P106H12,   P209D01,   P138B21

 Overgo Sequences

A sequence
GGTGGTCGAGATATTGAGAACCGT
B sequence
GCTGGATTGGTGCAATACGGTTCT
AB sequence
GGTGGTCGAGATATTGAGAACCGTATTGCA
Marker sequence
AGAAGCTGATAGTGAACACACCACAGTTACAGATAGTTATGAAAAGAAGT
CTGGTGGTCGAGATATTGAGAACCGTATTGCACCAATCCAGCAAAGAATT
AGAGCTTTGAGACAGGAAATTGATGATCTTCTGGAAATAATTGATGAGAT
ATAATTTCAGTGCAGACAACATTGATCCAATATAAATGGCTAAAATATTG
TTGTGAGGTGAACAACAGAATTAGGATCAATTCGAGATATTAGTTGATGC
AGCTGTATGTTGTTGAGAACCTGAATAACTTTGTAGGTGTAGAATTCTAG
GTTCTTGCCGAATCTCTTTGGTTGACAATCAAATGAGTGCTGTAGACAAC
TGTTTTTTCATATATATTGAGTTGTTAAGTTTATGGTTTTCTAACGTAAT
TGAGCTCATAGATTATCAAATTCCGACTTGATATTGCAAGTGAGTGCAAT
ACCTTATCAATGATCATGATGTCAGCATACGCATTATATTAT
Genomic location of TG587  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D447 marker 447
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)