SGN Marker CT61

SGN-M45

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT61 image not available
Forward sequence
TTTTTTTTTTTTTACAGAGAAATATAATTGTATAAATTTACAATTAACAAAACTATTCTGATGTGTTCTTCAGAAGGTTATACATGCAGC
CATGAACATTCAAGGGCTCCCTCTACTACCCACAAAATCTAGAGAAAAAGAAAAGATTATGTATCACTACAAAGGACAGCTCTTTTTAAT
GCATTAGCTTGTATCAAAATTGTGCTGTAGGTAGACCACCAATTATCCTGCTTGTTATCTCATGGATCAAACATCAAGTCGTGGCTTCTG
AACAAAAAGAATATATTTCCTACCGAGGAGACTCTTTTAACACCTGATTAGATTAGAATTGGGAAGATGTATATGGACGATCCTCTTGCT
TCTCTACAAGCACACATCTTGATGGCGGACCAAAAATGCTTAATAGTACAGGTAAAAATATGAGCCCATGTAGAAAACCAAGAAGAACCA
AAGCCAGGTACATTTGAAAGTAGTAAACCACAAAAACTTCTGTCCTTGAGAAACAAAGAACAATGACACCGACAAGCTTTGTAAGCGTGA
TACCACTGAATACA
Reverse sequence
TCTATGAATTCAGTTCAAGGGTTTCTGATTCTCTAAAGATGGAGGTCTTCCCGTATGCAGTGTTTTATATGTTCTTTGAGCAATATTTAA
GCATATGGAGGACAGCCCTAATTAACTTAGCGATTGCTATTGGTGCCGTATTTATTGTATGCTTAGTTATCACTTGTAGTTTTTGGACTT
CAGCAATTATCTTGCTCGTGCTGACCATGATTGTTCTGGATCTTATGGGAGTAATGGCAATTCTAAAAATCCAGCTCAATGCTGTATCAG
TTGTTAACCTTGTGATGGCCGATGGTATTGCTGTTGAATTCTGTGTCCATATAACACATGCCTTCTTGGTTAGCAGTGGAGATAGAAACC
AACGCATGAAGGAGGCACTGACTACTATGGGCGCTTCTGTATA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U151538541 (97.7% of RFLP seq)+
SGN-U151538397 (98.5% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 7857)
Chromosome
4
Position
119.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT61 was used as an overgo probe on plate 9 [well F12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGATCCTCTTGCTTCTCTACAAGC
B sequence
CGCCATCAAGATGTGTGCTTGTAG
AB sequence
CGATCCTCTTGCTTCTCTACAAGCACACAT
Marker sequence
TTTTTTTTTTTTTACAGAGAAATATAATTGTATAAATTTACAATTAACAA
AACTATTCTGATGTGTTCTTCAGAAGGTTATACATGCAGCCATGAACATT
CAAGGGCTCCCTCTACTACCCACAAAATCTAGAGAAAAAGAAAAGATTAT
GTATCACTACAAAGGACAGCTCTTTTTAATGCATTAGCTTGTATCAAAAT
TGTGCTGTAGGTAGACCACCAATTATCCTGCTTGTTATCTCATGGATCAA
ACATCAAGTCGTGGCTTCTGAACAAAAAGAATATATTTCCTACCGAGGAG
ACTCTTTTAACACCTGATTAGATTAGAATTGGGAAGATGTATATGGACGA
TCCTCTTGCTTCTCTACAAGCACACATCTTGATGGCGGACCAAAAATGCT
TAATAGTACAGGTAAAAATATGAGCCCATGTAGAAAACCAAGAAGAACCA
AAGCCAGGTACATTTGAAAGTAGTAAACCACAAAAACTTCTGTCCTTGAG
AAACAAAGAACAATGACACCGACAAGCTTTGTAAGCGTGATACCACTGAA
TACA
Genomic location of CT61  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D45 marker 45
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)