SGN Marker CT67

SGN-M451

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
650
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT67 image not available
Forward sequence
CTTTTTTTTTTTTTTCTTATTTGTTATATTCTTGAACTAGGGTTTACAGGAATAGCCAATTACCTAAGGCTTCTGATTCTAATTTTTTTA
TGCTTCTCAAAGACGGGGTTCTGGTGAAATGTGAGATCTATGGTGAAGTTCAAGTGAATTCTCATCTTTCTGGTCTTCCTGATCTTACCC
TTTCATTTGCAAATACTTCCATCCTGAATGATGTAAGATTCCATCCTTGTGTTCGACTACGACCATGGGAATCAAACCAAATTCTGTCTT
TTGTTCCTCCTGATGGACAATTCAAGCTCATGAGCTACAGGTTTGTGGTGTTAACTAGTGCAGTTGCCTCCACTCATGATCAAAATTTGG
TGGTTTTGACTTTATGTAAAAAGTACTCTAATCTTGTGCTTACATTTGGTATGTACTTGTACATCATAAAGTTATCTTCTATTTATTCCC
TCTGATACTGGAACCCATAAAATTAACCCCTTGCTTGCTTGGTAAGGAGGGTCAACCCAG
Reverse sequence
TTTTTTTTTTTTTTTGCTGGGTTGACCCTCCTTACCAAGCAAGCAAGGGGTTAATTTTATGGGTTCCAGTATCAGAGGGAATAAATAGAA
GATAACTTTATGATGTACAAGTACATACCAAATGTAAGCACAAGATTAGAGTACTTTTTACATAAAGTCAAAACCACCAAATTTTGATCA
TGAGTGGAGGCAACTGCACTAGTTAACACCACAAACCTGTAGCTCATGAGCTTGAATTGTCCATCAGGAGGAACAAAAGACAGAATTTGG
TTTGATTCCCATGGTCGTAGTCGAACACAAGGATGGAATCTTACATCATTCAGGATGGAAGTATTTGCAAATGAAAGGGTAAGATCAGGA
AGACCAGAAAGATGAGAATTCACTTGAACTTCACCATAGATCTCACATTTCACCAGAACCCCGTCTCTGAGAAGCATAAAAAAATTAGAA
TCAGAAGCCTTAGGTAATTGGCTATTCCTGTAAACCCTAGTTCAAGAATATAACAAATAAGAAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1479444e-116210 (41.2% of RFLP seq)+
SGN-U1479442e-117212 (40.5% of RFLP seq)-
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42970)
Chromosome
1
Position
43.70 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43970
Forward primer (5'-3')
TAGGGTTTACAGGAATAGCCAA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CCAAGCAAGCAAGGGGTTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39064)
Chromosome
1
Position
120.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9201)
Chromosome
1
Position
89.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT67 was used as an overgo probe on plate 14 [well C11]

Plausible BAC Matches:   P129F01

 Overgo Sequences

A sequence
TCCATCCTTGTGTTCGACTACGAC
B sequence
TGGTTTGATTCCCATGGTCGTAGT
AB sequence
TCCATCCTTGTGTTCGACTACGACCATGGG
Marker sequence
CTTTTTTTTTTTTTTCTTATTTGTTATATTCTTGAACTAGGGTTTACAGG
AATAGCCAATTACCTAAGGCTTCTGATTCTAATTTTTTTATGCTTCTCAA
AGACGGGGTTCTGGTGAAATGTGAGATCTATGGTGAAGTTCAAGTGAATT
CTCATCTTTCTGGTCTTCCTGATCTTACCCTTTCATTTGCAAATACTTCC
ATCCTGAATGATGTAAGATTCCATCCTTGTGTTCGACTACGACCATGGGA
ATCAAACCAAATTCTGTCTTTTGTTCCTCCTGATGGACAATTCAAGCTCA
TGAGCTACAGGTTTGTGGTGTTAACTAGTGCAGTTGCCTCCACTCATGAT
CAAAATTTGGTGGTTTTGACTTTATGTAAAAAGTACTCTAATCTTGTGCT
TACATTTGGTATGTACTTGTACATCATAAAGTTATCTTCTATTTATTCCC
TCTGATACTGGAACCCATAAAATTAACCCCTTGCTTGCTTGGTAAGGAGG
GTCAACCCAG
Genomic location of CT67  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D451 marker 451
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)