SGN Marker CT125

SGN-M452

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGTCGGCTTAAACGACGTTTTTAAATATCGTAAAACAAGTACAACATGGGGGAAGTTAC
CAATGTGATGGAGTTTGAAGCAATTGCAAAGCAAAAGTTGCCAAAAATGGGGTATGACTACTATGCATCTGGAACAAAGGATCAATGGAC
TTTGGCTGAAAACAAAAATGCCTTTTCAAAAATTTTGTTTAGGCCTCGTATTCTTATTGATGTAAGCAAGATTGACTTAAGCACAAGCGT
GCTCGGGTTCAATATCTCAATGCCTATCATGATTGCCCCAACAGCTATGCAGAAAATGGGTCATCCTGATGGTGAGTATGCTATAGCAAA
AACACCATCGGCAGCAGGAACAATTATGACACTGTCCTCTTGGGGAACTTCAAGTGTCGAGGAGGTTAATTCAACAGGACCTGGCACCCG
TTTTT
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1552428.1e-0653 (11.6% of RFLP seq)+
SGN-U1436183.9e-57331 (72.7% of RFLP seq)+
SGN-U1605896.3e-59182 (40.0% of RFLP seq)+
SGN-U1605925e-152378 (83.1% of RFLP seq)+
SGN-U143497408 (89.7% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9203)
Chromosome
10
Position
12.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT125 was used as an overgo probe on plate 5 [well H2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P044A19,   P250O10,   P020A13

 Overgo Sequences

A sequence
GTGCTCGGGTTCAATATCTCAATG
B sequence
GGGCAATCATGATAGGCATTGAGA
AB sequence
GTGCTCGGGTTCAATATCTCAATGCCTATC
Marker sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGTCGGCTTAAACGACGTT
TTTAAATATCGTAAAACAAGTACAACATGGGGGAAGTTACCAATGTGATG
GAGTTTGAAGCAATTGCAAAGCAAAAGTTGCCAAAAATGGGGTATGACTA
CTATGCATCTGGAACAAAGGATCAATGGACTTTGGCTGAAAACAAAAATG
CCTTTTCAAAAATTTTGTTTAGGCCTCGTATTCTTATTGATGTAAGCAAG
ATTGACTTAAGCACAAGCGTGCTCGGGTTCAATATCTCAATGCCTATCAT
GATTGCCCCAACAGCTATGCAGAAAATGGGTCATCCTGATGGTGAGTATG
CTATAGCAAAAACACCATCGGCAGCAGGAACAATTATGACACTGTCCTCT
TGGGGAACTTCAAGTGTCGAGGAGGTTAATTCAACAGGACCTGGCACCCG
TTTTT
Genomic location of CT125  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D452 marker 452
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)