SGN Marker C2_At1g63770

SGN-M4635
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple304553 (SGN)
119635 (CGN)
---
Capsicum annuumSingleSGN-U197447---
Lycopersicon CombinedMultipleSGN-U213664---
Solanum tuberosumSingleSGN-U244668---
ArabidopsisSingleAt1g63770 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38227)
Chromosome
8
Position
72.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39499
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
50°C
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200
Solanum lycopersicum TA209
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25349)
Chromosome
1
Position
23.66 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10332
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
50°C
  
PCR data   Exp. ID 10333
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
50°C
  
PCR data   Exp. ID 10334
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
50°C
  
PCR data   Exp. ID 12761
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12762
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12763
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12764
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12765
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12766
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12767
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12768
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32605
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32824
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32825
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32826
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32827
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32828
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 10335
Forward primer (5'-3')
AGGTGGAAACGTTATGATGAAAC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCGATTTCAAACACATTCTCTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 200
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g63770 was used as an overgo probe on plate 12 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTCTTTCCCACTTGTCCTAGATGG
B sequence
CAACTTCAGATCTCGCCCATCTAG
AB sequence
GTCTTTCCCACTTGTCCTAGATGGGCGAGA
Marker sequence
ATAAAAAGATTACAGCAGAAGGAGTTTTGTGTTCTTGTTGATCAACCCTT
TTGCAAATCATCATCAATAGAGTTTCAGGCNNNNNANNNNNAGTTGCCGT
GTTACTTCAGTTGGGCGCTCGAGGGATATCTGCAGATACAAAAAATACCT
TACTTCAGAGNNNNNGTTGCGCATTGGAGGAGGTGTCAAATCCCGCGTTT
TCCATTAGTTCAACCTAGAAGAATTGACCGGAGATTAATCTGTTCAGTTG
CAACTGAACCTCTACCAAAAGAAGTTGAAGAATCCAAGATGGAAGCACCA
AAGGAAATCTTTCTGAAGGATTACAAACAACCTGATTACTATTTTGACAC
GTTNNNNNGGATCTGAAATTCGCACTGGGTGAGGAAAGTACTATTGTCGC
TTCCAAAATTGCTGTCAACCCCAGAGTTGAAGGNNNNNTCAGTCTTTCCC
ACTTGTCCTAGATGGGCGAGATCTGAAGTTGCAATCAGTTAAGATCAACG
GCAATCCGCTGAAGGNNNNNAGGAAGATTTCCTCGTGGACTCGCGCCACC
TGACTCTGAAATCCCCTCCAAGTAGCAAATTCACCTTGGAGATTGTGACA
GAAATACATCCTCAGAAGAACACATCCTTAGAGGNNNNNGTCTTTACAAG
TCATCAGGGAATTTCTGCACCCAATGTGAGGCTGAGGGTTTCCGTAAGAT
TACGTTCTATCAGGNNNNNATCGCCCTGACATTATGGCAAAATACACTTG
TCGCATAGAGGCAGACAAATCCTTGTATCCTGTATTGTTGTCAAATGGAA
ACCTTATAGAGCAAGGGGATCTGGAGGNNNNNGAGGAAAGCATTATACTC
TTTGGGAGGATCCTTTCAAGAAGCCCAGTTATCTTTTTGCATTGGTTGCT
GGTCAGTTGGTGAGCAGAGATGACACATTTACAACCTGTTCAGGCCGTAA
GGTCTCCCTTAGAATCTGGACCCCTGCACAAGATCTGCCCAAGACAGAAC
ATGCCATGTATTCTCTCAAGGCAGCTATGAAGTGGGATGAAGATGTNNNN
NTTTCGGGCGGGAGTATGACCTGGATCTTTTTAATATTGTTGCTGTTCCA
GATTTTAACATGNNNNNGGAGCAATGGAAAACAAGAGCTTGAATNNNNNA
TATTCAATTCCAAGCTTGTCCTGGCATCCCCAGAAACTGCAACAGATGCT
GATTATGCGGCAATACTGGGTGTGATTGGACATGAGNNNNNTNNNNNACT
TCNNNNNCAGCTCAGTTTAAAGGAAGGACTTACTGTTTTCCGTGATCAGG
AGTTTTCGTCTGATTTGGGCAGCCGTCCTGTGAAAAGAATTGCTGATGTC
TCAAAGCTTCGAATGTATCAGTTCCCGCAGGNNNNNATGCTGGTCCAATG
GCTCATCCTGTAAGGCCTCACTCTTATATAAAGATNNNNNGGATAACTTC
TACACAGTTACGGTATATGAGAAGGNNNNNGAGCTGAAGTGGTCAGGATG
TACAAAACCTTGTTAGGTAGCCAAGGATTTAGAAAAGNNNNNGCACAGAT
TTATATTTTGAGAGGCATGATGGTCAAGCAGTAACATGTGAAGACTTTTT
TGCTGCCATGCGAGATGCCAACAATGCAGATTTTGCTAATTTCTTGTTAT
GGTNNNNNACTCGCAAGCTGGGACACCTGTAGTGAAGGTTACCACAAATT
ATAATGCTGAAGGGCGCACTTTCTCCCTCAAGTTTAGNNNNNTCAAGAGG
TGCCTCCAACCCCCGGCCAGTCTGCAAAAGAACCTATGTTTATTCCTGTT
GCTGTAGGTCTGCTGGATTCAAGTGGTAAGGACATGCCTCTATCTTCGGT
TCATCATGATGGGAAATTGGAGAGTTTTGCGAGCAGTGGTCAAAACGTAT
ACACCACAGTTCTCCGCGTAACGAAGNNNNNAAGGAGGAGGAATTTGTGT
TCAATGACGTATCTGAGAGGCCAACACCATCGATATTGCGAGGATTCAGT
GCTCCCATCAGGCTTGAGTCTGATCTCACTGATAGTGATCTTCTTTTCCT
TCTTGCTCATGATTCTGATGAGTTTAACCGGTNNNNNGGGAGGCGGGACA
AGTGTTGGCAAGGAAGTTGATGCTCAGTCTGGTAGCTGATTTCCAACAGA
ATAAGGCTTTGGTTCTTAACCCTCAGTTTTTGCAGGGGATCAAAAGCATA
CTCACCGACTCAAGCTTGGATAAGGNNNNNAATTCATTGCAAAGGCAATA
ACTTTGCCTGGTATAGGAGAAATCATGGACATGATGACGGTTGCTGATCC
AGATGCCGTTCATGCAGTGCGGACTTTCATCAGGAAGCAACTGGCTTCTG
AATTGAAACAAGAGTTCCTTATCACTGCNNNNNTAAAAACAACAGGAGCT
CTGGTGCTTATGAGTTTGATCATAACAATATGGCACGTCGTGCTCTTAAA
AATATTGCTCTTGNNNNNCTTATCTTGGATCACTTGAAAACCCAGAAATC
ACAGAACTTCTATTGAATGAATACAGAAACGCCACAAACATGACAGATCA
GTTTGCAGCTTTAGTGGCTATCGATCAGCAACCTGCAATTCGTGAAGAAA
TTTTGGCTGATTTCTATAACAAGTGGCAGGATGATTACTTGGTNNNNNTN
NNNNGTGAACAAGTGGCTTGCTCTTCAAGCTATGTCAGACATGCCTGGTA
ATGTTGAGAATGTCAAGAAACTTCTAAACCATACAGCCTTTGACCTATGT
AATCCAAATAAGGTTTATNNNNNTCGTTGATCGGAGGATTTTGTGGTTCA
CCTGTCAACTTCCATAGCAAGGATGGCTCCGGCTACAAGTTCTTGGGAGA
ACTAGTGGTGAAGCTTGACAAGATGAATCCACAGGTGGCTTCACGAATGG
TTTCAGCGTTCTCCAGGTGGAAACGTTATGATGAAACAAGACAGAGTCTC
GCGAAGGAACAATTGGAGATGATCTTGTCTACTGAGGGACTCTCAGAGAA
TGTGTTTGAAATCGCATCGAAGAGCTTGGCAGCTTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At1g63770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4635 marker 4635
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)