SGN Marker C2_At4g34700

SGN-M4640
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302552 (SGN)
122671 (CGN)
---
Capsicum annuumSingleSGN-U196971---
Lycopersicon CombinedSingleSGN-U216646---
Solanum tuberosumMultipleSGN-U245506---
ArabidopsisSingleAt4g34700 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49284)
Chromosome
1
Position
88.87 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47224)
Chromosome
1
Position
148.95 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41496)
Chromosome
1
Position
246.00 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43472
Forward primer (5'-3')
TTCCATGGGCACCTGGTGG
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
CAGCCTCTTCCTTGCCATAGTCATA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38713)
Chromosome
1
Position
160.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39883
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
Accessions and product sizes
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1000
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
1100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26919)
Chromosome
4
Position
16.56 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11575
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11576
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 11577
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13554
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13555
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13556
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13557
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13558
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13559
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13560
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13561
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13562
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13563
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13564
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13565
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13566
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13567
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33141
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33142
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33143
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33144
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 11578
Forward primer (5'-3')
TGAAGCATCCTACAATAAGTGGCG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTGAACTTGGAACCACCAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g34700 was used as an overgo probe on plate 13 [well A5]

Plausible BAC Matches:   P023C06

 Overgo Sequences

A sequence
TGAGCGGAATAGCATCGGTATCGT
B sequence
GCTCTTCGAGCTAAGAACGATACC
AB sequence
TGAGCGGAATAGCATCGGTATCGTTCTTAG
Marker sequence
ATGAGCGGAATAGCATCGGTATCGTTCTTAGCTCGAAGAGCATCGCAGAG
GGAGAGGGTTCGGATCCTCTACAGGCGTGCTCTCAGAGACACTCTTAATT
GGGCCGTCCATCGTCATCTCTTCTATCCTGATNNNNNGCGGATGCCCTAA
GGGAGCGATTTGAGGTCAACAGAAAAGTGNNNNNGAAGATGTTGAAACTA
TTGATAGACTTATAGCTGATGGTGAAGCATCCTACAATAAGTGGCGGCAC
CCTGATCCTTACATTGNNNNNTTCCATGGGCACCTGGTGGTTCCAAGTTC
AACAGAAATCCAGTGCCGCCAGAAGGGNNNNNATTGAGATAGTGTATGAC
TATGGCAAGGAAGAGGCTGAACTAGTATGANNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g34700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4640 marker 4640
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)