SGN Marker C2_At1g10500

SGN-M4641
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308258 (SGN)
125354 (CGN)
---
Capsicum annuumSingleSGN-U197791---
Lycopersicon CombinedMultipleSGN-U214674---
Solanum tuberosumSingleSGN-U262154---
ArabidopsisSingleAt1g10500 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38086)
Chromosome
5
Position
76.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39381
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
Accessions and product sizes
Solanum pennellii TA56
1250
Solanum lycopersicum TA209
1250
Approximate temperature
53°C
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
375+800
Solanum lycopersicum TA209
1250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24971)
Chromosome
1
Position
3.46 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9991
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Approximate temperature
53°C
  
PCR data   Exp. ID 9992
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Approximate temperature
53°C
  
PCR data   Exp. ID 9993
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1250
Approximate temperature
53°C
  
PCR data   Exp. ID 12384
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12385
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12386
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12387
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12388
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32592
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32680
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32681
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 32682
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 9994
Forward primer (5'-3')
ACGATTCAATCATCGAGTACAATGG
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 375+800
Solanum lycopersicum LA925: 1250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTAAACGATTTTCCACAACCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI, TaqI, HaeIII, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: HaeIII, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Solanum lycopersicum LA925: 1250
Approximate temperature
53°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g10500 was used as an overgo probe on plate 13 [well A6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTCGGAATGCAACTGGACTACAG
B sequence
GCCTATCAATGCATCGCTGTAGTC
AB sequence
CTTCGGAATGCAACTGGACTACAGCGATGC
Marker sequence
ATGGCGTTCTCTGCAACTCTTCGATGTTCATCTTCTCTACACCGCCCTTC
GAAGAATTCAACAATTTCAAGCGTTTTGCCTCAATCATCTTCTTCAATCT
CCTTTCGATCTTCGCCTTCGTTTTTTAATCGCAAAAAATCATTGTCTATT
CGATCTGCTACACTTGAAGNNNNNCAGCACCTGCATCTGGAGGAGTAGCA
CCTGCAATTTCCTTAACTGACAATGCATTAATGCACTTGAATAAAATGAG
GAGTGATCGGAATGAGGACTTGTGTCTTAGAATTGGCGTTAAACAAGGGG
GATGCTCGGGAATGTCATACACTATGGAGTTTGAAAAGCGAGAAAATGCT
AGACCAGACGATTCAATCATCGAGTACAATGGATTTGTTATTGNNNNNTT
TGTGATCCAAAAAGCCTTCTCTTCATCTTCGGAATGCAACTGGACTACAG
CGATGCATTGATAGGCGGGGGCTTCTCTTTCAAAAATCCAAACGCTACGC
AAACTTGTGGTTGTGGAAAATCGTTTACTGCTGAGATGTAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g10500  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4641 marker 4641
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)