SGN Marker C2_At5g27620

SGN-M4642
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311770 (SGN)
127841 (CGN)
---
Capsicum annuumSingleSGN-U198357---
Lycopersicon CombinedSingleSGN-U228276---
Solanum tuberosumSingleSGN-U245969---
ArabidopsisSingleAt5g27620 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38838)
Chromosome
1
Position
115.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39955
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27322)
Chromosome
5
Position
9.77 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11843
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11844
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11845
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13826
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13827
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13828
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13829
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13830
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13831
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13832
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13833
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13834
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13835
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13836
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13837
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 33249
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33250
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33251
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33252
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11846
Forward primer (5'-3')
ATCTACAATGGTCCGTGATGGAAC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCTCTGCCTTGCAAGCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g27620 was used as an overgo probe on plate 13 [well A9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGGTCGTTCTCATATGCTGAAAGC
B sequence
CTTTGGCGTCATTTTGGCTTTCAG
AB sequence
GGGTCGTTCTCATATGCTGAAAGCCAAAAT
Marker sequence
ATGGCTGATTTTGTGACATCTACTCATAGAACCAAGTGGATTTTTACTCC
CCAAGATATTNNNNNAAACATAAGTATAAAGTTGCTAATCACAGAGCGAA
ACAAGCACTGGAGAAGNNNNNTATGGAACAACGCGAATGGAAGTTGATAT
TGATGGGTCGTTCTCATATGCTGAAAGCCAAAATGACGCCAAAGATAATG
NNNNNCTGAAAAGCGTCCTAAACCACTCAAGGTTGAAGAAGAACAACTTC
TAAAGGCTTTCTACGAGTTCAAAATTCAAGACGTCTGTGATGCCTTTAAG
TTCCCACGTAAGATTCAGNNNNNGCGACAGCTCTCATTTATTTTAAGAGG
GTTTATCTACATGGTCCGTGATGGAACATCACCCCAAAGACATTATGNNN
NNTTAACCTGCATATATGCAGCTTGCAAGGCAGAGGAAAACCATGTATCA
GCTGAGGGACTTGGGNAAGGGGATTGGACAGGATCATCATGTAATCCTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Forward amplicon sequence for Physalis spp. TA1367, plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Forward amplicon sequence for C. canephora BP409, plain text
Reverse amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Reverse amplicon sequence for Physalis spp. TA1367, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Reverse amplicon sequence for C. canephora BP409, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Forward amplicon sequence for Physalis spp. TA1367, plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Forward amplicon sequence for C. canephora BP409, plain text
Reverse amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Reverse amplicon sequence for Physalis spp. TA1367, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Reverse amplicon sequence for C. canephora BP409, plain text
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g27620  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4642 marker 4642
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)