SGN Marker C2_At5g04910

SGN-M4643
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310282 (SGN)
125515 (CGN)
---
Capsicum annuumSingleSGN-U198454---
Lycopersicon CombinedSingleSGN-U242006---
Solanum tuberosumSingleSGN-U258707---
ArabidopsisSingleAt5g04910 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38746)
Chromosome
10
Position
33.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39905
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
Accessions and product sizes
Solanum lycopersicum TA209
850
Solanum pennellii TA56
850
Approximate temperature
55°C
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
200+300
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27031)
Chromosome
5
Position
1.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11627
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11628
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11629
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13627
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13628
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 450+800
Approximate temperature
55°C
  
PCR data   Exp. ID 13629
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13630
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13631
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13632
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13633
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13634
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13635
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13636
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33167
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33168
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33169
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33170
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 11630
Forward primer (5'-3')
TCAACTTACCAACAGCTATGCAGTG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 200+300
Solanum pennellii LA716: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTGGCGGTCAGTTGCAGCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, MspI
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g04910 was used as an overgo probe on plate 13 [well A11]

Plausible BAC Matches:   P328M14,   P333J08,   P185D08,   P031D08,   P137F06,   P089F02,   P235M14,   P163O16,   P181D17,   P043H14,   P310A08,   P271C14,   P289P07

 Overgo Sequences

A sequence
GCGTGCATATCCAGAAGATAACCG
B sequence
TCAGTGCCTGAAGCTTCGGTTATC
AB sequence
GCGTGCATATCCAGAAGATAACCGAAGCTT
Marker sequence
ATGAGGAAGTGGAGCATGGTTGAAGAATTGGAGAAGGTAGAAATTTCGGA
GGAAGGTAATCATGGAGAGAGGGATTCATTGAAAATTGTGGCAGTGCTTC
GAAGATTTGTGGGTGTGCAGCAACGCAGAGCCGAAGCTTATGCGAGGCTG
AAGCGNNNNNAGGATTTGAAGATTATATGGCTTCAGGAGTAGAATCAACT
TACCAACAGCTATGCAGTGAGATCACTGATGAATTTAATGATTGCTCAAA
GCAGNNNNNGTCCTTGAGATGGAGTCTCAGTTTCTAACTGCCCATTGCTT
CCGAGAAGATCTGTCTCTACTTTTGAGATCTGTTCAAAATCAAGAAAAGA
TGAAGCTGCAACTGNNNNNACCGCCACAATACAAGTCTTGAAAAGAGCTG
GCCGCCCCTCGGAGCGTCCAGTGAGTCATGAAAATTGTAGATTTAGTAAG
CCAACTGGACATGAATGCGTGCATATCCAGAAGATAACCGAAGCTTCAGG
CACTGAAGAAGCAGAAGCTGATGCTGAATTTGATAATGCTCTC
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g04910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4643 marker 4643
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)