SGN Marker C2_At2g34560

SGN-M4644
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312033 (SGN)
132430 (CGN)
---
Capsicum annuumSingleSGN-U197419---
Lycopersicon CombinedSingleSGN-U214228---
Solanum tuberosumMultipleSGN-U243806---
ArabidopsisSingleAt2g34560 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46469)
Chromosome
2
Position
40.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42200)
Chromosome
2
Position
32.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43765
Forward primer (5'-3')
TAAGTGGGAGAGCATTAAAGGATT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCCTGTTCCAGGAGGGCCAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41385)
Chromosome
2
Position
56.10 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43361
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
ACTGTTGATGTGTGTAGAAATGCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38358)
Chromosome
2
Position
38.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39611
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
Accessions and product sizes
Solanum pennellii TA56
920
Solanum lycopersicum TA209
920
Approximate temperature
55°C
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
920
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25815)
Chromosome
2
Position
14.57 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10777
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 10778
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 10779
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 13019
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 13020
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 13021
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13022
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13023
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13024
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13025
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13026
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13027
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 13028
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13029
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13030
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32942
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32943
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32944
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32945
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10780
Forward primer (5'-3')
AGTTGTTAGCAAATGGCGTGGTG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 920
Solanum lycopersicum LA925: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATCGAGAAAGATGGTTGAAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI, HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 920
Solanum pennellii LA716: 920
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At2g34560 was used as an overgo probe on plate 13 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAAAGGTATCCTCCTTTTTGGCC
B sequence
TTTCCTGTTCCAGGAGGGCCAAAA
AB sequence
GGAAAGGTATCCTCCTTTTTGGCCCTCCTG
Marker sequence
ATGGCCGACGAACCTGCGTTGACTCGATGGACCTTTCCGNNNNNTTTGGG
AGGAGGAAGGTTCCTGCACGAGATGCAACTGACAATGGTGATTCTGTGCA
AAATGGAAATTCTTCAACTATGAATGGAAATGGATCTGTGCGGAACACTG
CAGAATTATCCATTTTCGAGCAGTATAATCAGGCTAATGGANNNNNGTTC
AGTCTGCCGGAGTGGATGGAAAACCNNNNNGGAAAAATCTCTACTTCCTC
CTTTCGAGTCTGCAGAAATGCGCACTTTAGCAGAAAGCTTAACCAGNNNN
NGGATATTCTTCGTGGTAATCCAGATGTTAAGTGGGAGAGCATTAAAGGA
TTAGAGACTGCCAAGCGTCTACTAAAAGAAGCAGTTGTCATGCCTATTAA
ATATCCAAANNNNNGTATTTTAAAGGTCTTTTAACTCCTTGGAAAGGTAT
CCTCCTTTTTGGCCCTCCTGGAACAGGAAAGNNNNNACCATGCTTGCGAA
GGCAGTTGCAACTGAATGCAATACCACATTTTTCAATATCTCAGCATCAT
CAGTTGTTAGCAAATGGCGTGNNNNNGTGATTCTGAAAAATTGATAAAAG
TGTTATTCGAGCTCGCTAGGCATCATGCTCCTTCAACCATCTTTCTCGAT
GAAATTGATGCCATTATCAGTCAACGCGGGGAAGCGCGCAGTGAGCATGA
ATCTAGTAGGCGTTTAAAAACAGAACTGCTCATACAGNNNNNATGGACGG
TTTGAATCGGACAGATGAACTTGTCTTTGTTCTTGCTGCAACAAATCTTC
CCTGGGAACTGGATGCAGCAATGCTCCGACGTCTTGAGAAGCGGNNNNNA
TCCTTGTGCCCCTTCCGGAGGCAGAAGCAAGGTGCGGGATGTTTGAGGAT
TTACTACCATCCCTTCCTGAAGAGGCGCCACTTCCATATGATTTATTGGT
AGAAAAGACAGAAGGCTTTTCTGGTTCTGATATTCGGCTATTATGCAAGG
AGGCTGCCATGCAACCATTACGACGTCTAATGGCAGAACTTGATAAGAGG
GAAGAATTGGTGCCTGAGGATGNNNNNAGTTGCCCAATGTTGGACCAATA
ACTGTGACAGATATCGAGGTGGCACTGAAGAACACGAGACCATCTGCACA
CCTACATGCACCTAGGTACGATAAGTTCAATTCAGATTATGGCAGCCATG
CTCTCCAGTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At2g34560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4644 marker 4644
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)