SGN Marker C2_At3g52220

SGN-M4648
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312142 (SGN)
126998 (CGN)
---
Capsicum annuumSingleSGN-U202666---
Lycopersicon CombinedMultipleSGN-U218204---
Solanum tuberosumSingleSGN-U245879---
ArabidopsisSingleAt3g52220 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46693)
Chromosome
5
Position
72.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38554)
Chromosome
11
Position
10.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39762
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
400
Solanum lycopersicum TA209
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26428)
Chromosome
3
Position
19.38 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11219
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11220
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11221
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13289
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 300+500
Approximate temperature
55°C
  
PCR data   Exp. ID 13290
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13291
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13292
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13293
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13294
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13295
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13296
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13297
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 420
Approximate temperature
55°C
  
PCR data   Exp. ID 13298
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13299
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13300
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 420
Approximate temperature
55°C
  
PCR data   Exp. ID 33049
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33050
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33051
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 11222
Forward primer (5'-3')
TGCTCGGGTGGATGGTCTTGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGGTGAACTTGGTTCTTCCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g52220 was used as an overgo probe on plate 13 [well B8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAAGAGACGAGAAGAGAAGAGACG
B sequence
CCTCTCATCCTTTTCCCGTCTCTT
AB sequence
GAAGAGACGAGAAGAGAAGAGACGGGAAAA
Marker sequence
GTCATTCTGTGTTCTCCGTTTTCAACACCTCAATTTTGAGTTCATTTGTG
AAATTCAAAATCTGAGTTTAGAGAGGAGAAGAAGGGGCAAACGATGTATC
ATCCTACTAGAGGCGGCGTTCGTGGCGGCCGAGATCNNNNNAATTTAGTT
GGGATGATGTGAAGGTTGATAAACATCGAGAAAATTATATTGGCCATAGT
ATCAAAGCAGCAGTTGGGAGATGGCAGAAAGNNNNNGGAAAGATCTTCAT
TGGTACACCCGTGATAAGAAATCCCAGGATAAGGATATGGAGGCAGCAAA
AGAAGAAATACGTAGGATTAAAGAAGAGGAGGAGCAGTCAATGAGGGAGG
CTCTGGGCTTAGCTCCTAAGCGTGCCACACGTCCTCAAGGTACTCGGCTA
GACAAACATGAGTTGTCTGAACTTGTGAAGAGAGGTTCAACTGCAGAAGA
CTTGGGAGCAGGGCATTCTGAAGCTGCTCGGGTGGATGGTCTTGGTTTCT
CAAANNNNNATTGCCCAAGCCTTGGGAAGAACCAAGTTCACCATCAGCTT
TTCCATCTAATCCGATCGATGAGCCTGTAGAAAAGATTAATGCAAGTCTC
CCTGTTGCACCCCTACAGAATGAAGAAGAGTCTGAGGACGAAAGGAGCCA
AAAGAAGAAGAGACGAGAAGAGAAGAGACGGGAAAAGGATGAGAGGAGAG
ATAAGCGACATTTGCATGATACAAATGATAGAAGGAAGCATTCCCGCGAT
TCAGATGACAGGAGGAAACGTTCCCGTGATTCTGACGATAAGAGGAAGCA
CACCCGCGATTCAGATGACAGGAAGAAACACAAGAAAGACAAGGAGAAGA
GAAGAAGACATGATTCTGATTCAGATTAAACTTCAATAAATCCTTTTAGT
TATTGTGTGCTTGCTATCATTTACCTTAACGATTTCATTCTGAATATTTG
TGTTGAATTCAGTTTGTTCTGTTGTATTTAGATGGAAAAAGGTCAGATAT
ACTCTTCAGCTTGTATTTATTAAAAAAAAAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g52220  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4648 marker 4648
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)