SGN Marker C2_At1g44575
SGN-M4649
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species
| Synonyms |
| Locus associations |
| Orthologs in this COSII group |
| Species | Copies | Sequence ID | CDS/Edited sequence | Peptide sequence | Predicted introns |
|---|---|---|---|---|---|
| Coffee | Single | 299798 (SGN) 120341 (CGN) | - | - | - |
| Capsicum annuum | Single | SGN-U197157 | - | - | - |
| Lycopersicon Combined | Single | SGN-U213287 | - | - | - |
| Solanum tuberosum | Multiple | SGN-U243646 | - | - | - |
| Arabidopsis | Single | At1g44575 on TAIR | - | - | - |
Mapped locations
|
| ![]() Tomato-EXPEN 2000 |
| ||||||||||||||||||
| ![]() Arabidopsis COSII |
| Other PCR data |
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| ||||||||||||||
| Unigene blast matches for primers |
| Overgo hybridization and physical mapping |
C2_At1g44575 was used as an overgo probe on plate 13 [well B9]
Plausible BAC Matches: P216P21
Overgo Sequences
|
A sequence
CTTCTTGGAGCCATTGGAGCTTTG
|
|
B sequence
ATTTGCCTCTGTCTCCCAAAGCTC
|
|
AB sequence
CTTCTTGGAGCCATTGGAGCTTTGGGAGAC
|
|
Marker sequence
ATGGCTCAAACAATGTTGTTAACAGCCAATGCCAAAGTTGATTTAAGGAG
TAAAGAATCTTTAGTTGAAAGACTAAAACCAAAGCCTTTGTCTTCTTTGT TCCTACCTTCTCTTCCTTTGAGATTTTCTTCTTCTTCCACTAATGCTTCT TCTTCAAAATTCACTAGTACTACTGTTGCTCTATTCAAGTCAAAAGCTAA AGCTCCTCCCAAAAAGNNNNNGTTGCACCACCAAAGGAAAAGCAAAAGGT GGAGGATGGGATTTTTGGTACCTCCGGAGGAATTGGCTTCACTAAGCAAA ATGAGCTATTTGTTGGCCGTGTTGCTATGATTGGTTTTGCTNNNNNGCCT CTTTGTTGGGAGAAGCAATAACAGGAAAAGGTATTTTGGCACAATTAAAT CTTGAAACTGGAATTCCAATCTATGAAGCAGAGCCACTTCTATTGTTCTT CATTCTATTCAATCTTCTTGGAGCCATTGGAGCTTTGGGAGACAGAGGCA AATTTGTTGATGACCCTACCCCTCCTACTGGCCTTGAAAAGGCTGTTATC CCTCCTGGCAAATCCTTCAAATCTGCTTTGGGACTCAGTGAAGGAGNNNN NGTCCATTGTTTGGATTCACAAAGGCAAATGAGTTGTTTGTAGGGAGATT GGCACAATTGGGAATTGCATTTTCCATTATAGGTGAAATTATTACAGGGA AAGGAGCATTGGCACAATTGAACTTTGAGACAGGTGTCCCAATCAATGAG ATTGAGCCTCTTTTGTTGTTTAACATTGCCTTCTTCTTCTTTGCTGCTAT AAATCCTGGTACTGGCAAATTTATCACTGATGAGGAAGAAGATTAG |
| Universal primers for Asterid species |
No additional PCR data found.
| Other COSII sequence data |
BLASTX result of original unigene sequences against Arabidopsis protein database
Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree | [View]
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
BLASTX result of original unigene sequences against Arabidopsis protein database
Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree | [View]
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Forward amplicon sequence for Petunia axillaris parodii TA3310, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for Petunia axillaris parodii TA3310, AB1 chromatogram - [View]
Reverse amplicon sequence for Petunia axillaris parodii TA3310, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Related Markers
|
Related Genotyped Markers: These markers have been genotyped and share a name with this marker
Genomic location of C2_At1g44575
|
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Mapped locations
Mapped locations


