SGN Marker C2_At5g25760

SGN-M4651
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301734 (SGN)
123753 (CGN)
---
Capsicum annuumSingleSGN-U198046---
Lycopersicon CombinedSingleSGN-U216051---
Solanum tuberosumSingleSGN-U254400---
ArabidopsisSingleAt5g25760 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49295)
Chromosome
11
Position
51.88 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47236)
Chromosome
11
Position
111.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46761)
Chromosome
1
Position
105.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper Capsicum   
Map version
65 (location: 42690)
Chromosome
11
Position
96.60 cM
Confidence
uncalculated
Protocol
PCR


Pepper Capsicum

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38828)
Chromosome
11
Position
89.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39949
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27304)
Chromosome
5
Position
8.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11819
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11820
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11821
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13812
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13813
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13814
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13815
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13816
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13817
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 13818
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 13819
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13820
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 13821
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13822
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 450+1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13823
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13824
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13825
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 33245
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33246
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33247
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 33248
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 11822
Forward primer (5'-3')
TCCTTATGATGGTGGAGTTTTCCAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGCAATTATAGCTCGACAAACAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: AluI,DraI,TaqI,RV,HaeIII,HinfI,DpnII,KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g25760 was used as an overgo probe on plate 13 [well B11]

Plausible BAC Matches:   P176F18

 Overgo Sequences

A sequence
CGCTAAACTGTGACTCAGGCAATC
B sequence
TCACCGGATCGAAGAAGATTGCCT
AB sequence
CGCTAAACTGTGACTCAGGCAATCTTCTTC
Marker sequence
ATGCAGGCTTCAAGGGCAAGACTTTTCAAGGAGTACAAAGAAGTACAGAG
AGAGAAAACAGCTGNNNNNATCCTGATATTCAATTAGTTTGTGATGACTC
TAATATNNNNNCTTTAAATGGACGGCTCTTGTTAAAGGGCCATCTGAAAC
TCCTTATGATGGTGGAGTTTTCCAGCTCGCTTTCTCAGTTCCAGAGCAGT
ATCCATTGCAACCTCCTCAAGTGCGGTTCCTGACCAAAATATTTCACCCA
AATGTTCATTTTAAGACCGGAGAGATTTGCCTTGATATTTTGAAAAATGC
ATGGAGCCCAGCATGGACACTCCAGTCTGTTTGTCGAGCTATAATTGCTT
TGATGGCTCANNNNNTCCTGAAGCTGATAGCCCGCTAAACTGTGACTCAG
GCAATCTTCTTCGATCCGGTGATATCAGAGGTTACCAGTCAATGGCAAGG
ATGTACACTAGGCTTGCTGCAATGCCCAAGAAGGGCTAANNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g25760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4651 marker 4651
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)