SGN Marker C2_At3g10920

SGN-M4655
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301995 (SGN)
124261 (CGN)
---
Capsicum annuumSingleSGN-U197943---
Lycopersicon CombinedSingleSGN-U215318---
Solanum tuberosumSingleSGN-U245568---
ArabidopsisSingleAt3g10920 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41408)
Chromosome
5
Position
70.90 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43384
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GATGAGCACTCATGAAAGTTGGACTTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38450)
Chromosome
6
Position
13.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39691
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
650
Approximate temperature
55°C
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300
Solanum pennellii TA56
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26123)
Chromosome
3
Position
3.42 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11013
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11014
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11015
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13182
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 620
Approximate temperature
55°C
  
PCR data   Exp. ID 13183
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13184
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 620
Approximate temperature
55°C
  
PCR data   Exp. ID 13185
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 620
Approximate temperature
55°C
  
PCR data   Exp. ID 13186
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 620+800
Approximate temperature
55°C
  
PCR data   Exp. ID 13187
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 620
Approximate temperature
55°C
  
PCR data   Exp. ID 13188
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 620+1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13189
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 620+1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13190
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 620
Approximate temperature
55°C
  
PCR data   Exp. ID 32632
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33010
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33011
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33012
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 620
Approximate temperature
55°C
  
PCR data   Exp. ID 33013
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 620
Approximate temperature
55°C
  
PCR data   Exp. ID 11016
Forward primer (5'-3')
TGGCTTGGTGTGGACAAAGAGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAGTAGTATGCGTGTTCCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g10920 was used as an overgo probe on plate 13 [well C5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTGAACAGCTCCATGATGCCATC
B sequence
GAGCATCTCCTTTGGAGATGGCAT
AB sequence
CTTGAACAGCTCCATGATGCCATCTCCAAA
Marker sequence
ATGGCTCTTCGGACTTTAGTGAGCAGACGGACCTTAGCGGCAGGGCTAGG
GTTCCGCCAACAACTTCGTGGCGTTCAAACCTTTTCGCTCCCCGATCTCC
CATACGACTATGGCGCCCTGGAGCCGGCAATTAGCGGTGATATAATGCAG
CTCCACCACCAGAAGCATCATCAGACTTACATCACTAATTACAATAAGGC
CCTTGAACAGCTCCATGATGCCATCTCCAAAGGAGATGCTCCTGCCGTCG
CCAAATTGCACAGTGCCCTCAAATTTAACGGCGGAGNNNNNGTCATATTA
ATCACTCAATTTTCTGGAATAACCTTGCCCCTGTCAGCNNNNNGAAGGTG
GTGGGGAGCCTCCAAAGGGTTCTCTTGGCTGGGCTATTGACACTAACTTT
GGTTCACTGGAAGCTTTAGTAAAAAAGATGAACGCAGAAGGTGCTGCTTT
ACAGGGCTCTGGCTGGGTGNNNNNTGGCTTGGTGTGGACAAAGAGCTTAA
GCGCCTGGTGGTTGAAACCACTGCAAATCAGNNNNNGACCCTTTGGTTTC
TAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACG
CATACTACTTGCAGNNNNNTACAAAAATGTAAGACCAGATTACCTGAAGA
ATATATGGAAAGTTATCAACTGGAAATATGCCAATGATGTTTACGAAAAT
GAGTGCCCCTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g10920  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4655 marker 4655
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)