SGN Marker C2_At3g16150

SGN-M4656
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301023 (SGN)
124533 (CGN)
---
Capsicum annuumSingleSGN-U196433---
Lycopersicon CombinedSingleSGN-U218429---
Solanum tuberosumMultipleSGN-U245845---
ArabidopsisSingleAt3g16150 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41418)
Chromosome
4
Position
122.90 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43394
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CTAGCTTCAGCATACCAACATTGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38473)
Chromosome
4
Position
97.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39712
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
Accessions and product sizes
Solanum lycopersicum TA209
400
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
100+150
Solanum pennellii TA56
150+200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26184)
Chromosome
3
Position
5.47 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11062
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11063
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11064
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13228
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13229
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13230
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13231
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 33028
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 33029
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 11065
Forward primer (5'-3')
AAGCAACTCCTTACTCGTTGCC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 100+150
Solanum pennellii LA716: 150+200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGATACCAGAAACGGCG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
C2_At3g16150 was used as an overgo probe on plate 13 [well C8]

Plausible BAC Matches:   P214B18,   P171B21,   P308D07,   P122I24,   P018K15,   P206I03,   P145G05,   P068A12,   P214C02,   P316E10,   P297M18,   P147G09,   P165C11

 Overgo Sequences

A sequence
ACATTGGAATCTCCGCTCTTCGCT
B sequence
ATGGCAGGTAGAGAAGAGCGAAGA
AB sequence
ACATTGGAATCTCCGCTCTTCGCTCTTCTC
Marker sequence
ATGGGCGGTTGGGCTATAGCGGTGCACGGTGGCGCTGGTGTGGACCCAAA
TCTCCCAGATGAACGTCAACAACAAGCTAAGCAACTCCTTACTCGTTGCC
TTAACATTGGAATCTCCGCTCTTCGCTCTTCTCTACCTGCCATTGATGTC
GTTGAACTCGTTNNNNNGTGAGAGAACTTGAAAGTGATCCTCTATTCAAT
TCGGGTCGTGGATCTGCATTAACTGCAAATAGAACAGTGGAAATGGAGGC
GAGCATTATGGACGGCGATGGTAGACGATGCGGCGCCGTTTCTGGTATCT
CCACCGTGAAAAACCCAATTTCTCTCGCTCGCCTTGTCATGGATAAATCC
CCTCATTCTTACCTCGGTTTCTCCGGCGCCGAAGAATTCGCCAAACAACA
GNNNNNGGCGTGGAAATGGTAGACAATGAATATTTCATAACTGAGGACAA
TGTTGGTATGCTGAAGCTAGCCAAAGAGGCTAACACCATTTTGNNNNNTT
CGATTACAGAATTCCATTAACTGGATTGGATTCGTGTGCGGCATCCGTTG
AAAGCCCAATTCACATGAACGGATTACCGATAAATATTTATGCACCGGAG
ACGGTCGGATGTGTGGTGGTAGACCGGCAAGGCAGGTGCGCCGCCGGTAC
TTCCACCGGTGGTTTAATGAACAAAATGACCGGTCGGATCGGTGATTCAC
CTCTGATTGGTGCTGGGACCTACGCCGGTGAGCTTTGTGGGGTGTCATGT
ACAGGTGAAGGAGAAGCTATCATACGTGGTACCCTAGCACGTGACGTGGC
AGCAGTTATGGAATACAAGGAATTGGGTCTTCAAGACGCAGTAAACTTTG
TGATTAAGAAGAGATTGGATAAAGGTTTCGCTGGGCTTATTGCTGTGTCT
AACAAGGGNGAAGTGGCTTTTGGGTTTAATTGTAATGGAATGTTTAGAGG
ATGTGCTACTGAAGATGGATTTATGGATGTTGGTATTTGGTAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g16150  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4656 marker 4656
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)