SGN Marker C2_At4g10030

SGN-M4658
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301352 (SGN)
125304 (CGN)
---
Capsicum annuumSingleSGN-U203233---
Lycopersicon CombinedSingleSGN-U221568---
ArabidopsisSingleAt4g10030 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46713)
Chromosome
6
Position
73.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41467)
Chromosome
1
Position
122.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43443
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38625)
Chromosome
6
Position
44.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39811
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
Accessions and product sizes
Solanum pennellii TA56
1650
Solanum lycopersicum TA209
1650
Approximate temperature
50°C
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1650
Solanum lycopersicum TA209
450+1100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26647)
Chromosome
4
Position
6.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11372
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
50°C
  
PCR data   Exp. ID 11373
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
50°C
  
PCR data   Exp. ID 11374
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
50°C
  
PCR data   Exp. ID 13383
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 510
Approximate temperature
55°C
  
PCR data   Exp. ID 13384
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13385
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13386
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 800+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32640
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33083
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33084
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33085
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 43803
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGTAGGTATGGAGGCCTACTGATAA
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
PCR data   Exp. ID 11375
Forward primer (5'-3')
TCGCGTCAGCTGCTCTTGATGTC
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 450+1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTCCAAAGCTGTGACCAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI, EcoRV, HinfI, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Solanum pennellii LA716: 1650
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g10030 was used as an overgo probe on plate 13 [well C10]

Plausible BAC Matches:   P297B12,   P106K23,   P267E17,   P004H17,   P266E17,   P038A12,   P173H18,   P195O08,   P033P06,   P327E10

 Overgo Sequences

A sequence
AACTTTCCAGCGGGAAGGTTGTTG
B sequence
AGCACTTCAGATGGCACAACAACC
AB sequence
AACTTTCCAGCGGGAAGGTTGTTGTGCCAT
Marker sequence
ATGTCGGCTATTTCGAATTTCACGGCGTGCCGGCGTTTCCAAAATGGAGC
TGCATTAACAAAAGACTCACCTGGGGTTGGTTTGATTACTAACAAGTTTC
TGGCGACCNNNNNAAGATTTCTACGCCATTCCACAAGGTGTCTCTCGTAT
GTTCAAAAAGGACGTTTAAAGGTTCAAATATAAGAATGACAATGTTAGAT
GACAAACTTTCCAGCGGGAAGGTTGTTGTGCCATCTGAAGTGCTGNNNNN
GCATATGAGCTCGTTCAAGGAGCAAAANNNNNGTAAAATGGAGTTATATT
ATGGAGGGATCGTTGCCTGAACCACCGACTGCTGTTCTCTTGCATGGTAT
TCTTGGCAGCAGGAAAAACTGGGNNNNNGAAGCTTTGCTAGGAGATTGGC
CCAAGAATTTCCGAAATGGCAGNNNNNTTTCTCCTGGTGGACTTGCGGTG
CCATGGTGATTCAGCATCCCTCAAGAAGAGAGGCACACATACAGTCGCGT
CAGCTGCTCTTGATGTCCTAAAGCTGNNNNNCTTGGCCAGCTCAGACTGA
CTCCCCGAGTTGTAGTTGGTCACAGCTTTGGAGGAAAAGNNNNNTTGCAT
TGAGCATGGTTGAGCAGGTTCCAAAGCCCCTTGCACGGCCTGTTAGANNN
NNGTCTGGGTTCTAGATGCCACTCCAGGAGAGGTTCGAGCTGGTGCAGAT
GGAGATGATCATCCAGCTGAATTGATATCATTTCTGAGTAATTACCAAAA
GAGGAAGNNNNNGTCTCTTCAAAACGAGATATTGTGGATGCTCTGATACA
AGAAGGTTTTTCCAGGGATGTAGCACAGNNNNNTGGGTGGTAACTAACCT
TCGTCAANNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g10030  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4658 marker 4658
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)