SGN Marker C2_At5g60990

SGN-M4659
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310869 (SGN)
127617 (CGN)
---
Capsicum annuumSingleSGN-U198094---
Lycopersicon CombinedSingleSGN-U215535---
Solanum tuberosumSingleSGN-U266912---
ArabidopsisSingleAt5g60990 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132196)
Chromosome
4
Position
25.93 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46785)
Chromosome
10
Position
62.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41547)
Chromosome
10
Position
11.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43523
Forward primer (5'-3')
TGATACACTGAAGCAGCAGTATCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCAGAAGACGAGTTGCATCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38907)
Chromosome
10
Position
14.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40009
Forward primer (5'-3')
TGATACACTGAAGCAGCAGTATCG
Accessions and product sizes
Solanum lycopersicum TA209
1400
Solanum pennellii TA56
1400
Approximate temperature
50°C
Reverse primer (5'-3')
AGCCAGAAGACGAGTTGCATCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1400
Solanum pennellii TA56
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27620)
Chromosome
5
Position
24.57 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12070
Forward primer (5'-3')
TGATACACTGAAGCAGCAGTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCAGAAGACGAGTTGCATCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
50°C
  
PCR data   Exp. ID 32586
Forward primer (5'-3')
TGATACACTGAAGCAGCAGTATCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCAGAAGACGAGTTGCATCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 12071
Forward primer (5'-3')
TGATACACTGAAGCAGCAGTATCG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 1400
Solanum pennellii LA716: 1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCAGAAGACGAGTTGCATCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HinfI, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: AluI, DraI, HinfI, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g60990 was used as an overgo probe on plate 13 [well C11]

Plausible BAC Matches:   P310L01,   P273F02,   P016N06,   P039G09

 Overgo Sequences

A sequence
GGTTTTCACTCGCACATGTGATGC
B sequence
AGCCAGAAGACGAGTTGCATCACA
AB sequence
GGTTTTCACTCGCACATGTGATGCAACTCG
Marker sequence
ATGGATGAATCCAAAGAAGAAACGAAGTCTTTCAAAGAATTAGGAGTTTG
TGATCAATTGATTGAGGCTTGTGATAATTTGGGTTGGAAAAACCCTTCTA
AGATACAAGCTGAAGCTATGCCTCATGCCTTTGAAGNNNNNGCAAAGACC
TAATTGGTCTGGCACAAACGGGTTCTGGAAAGACGGGAGCTTTTGCAATT
CCTATACTGCAATCCTTATTAGATTCTCCGCATGCCTTTTTTGCCTGTGT
TCTCTCTCCAACAAGNNNNNAGAGCTCGCCATTCAAATTGCTGAACAGTT
TGAAGCTTTAGGATCCGGTATTGGAGTAAAATGTGCAGTGNNNNNCTGGT
TGGAGGGATAGATCAAGTACAACAGAGCATTGCCCTCGGGAAACGACCTC
ACATTGTTNNNNNGTTGCAACACCTGGTCGCCTCTTGGATCATCTTTCCA
ATACCAAAGGGTTTTCTCTCCGTACGATAAAGTACTTGNNNNNGTATTAG
ATGAGGCGGACAGGTTGCTAAATGAGGATTTTGAGAAGGCCCTCGATCAG
ATTTTGAATGCTATTCCCCATGAACGAAGGACTTATCTCTTTTCTGCTAC
AATGACCAAAAAGNNNNNGTGCGGAAACTTCAGAGGGCTTGTTTGAGAAA
TCCTGTTAAGNNNNNATTGAAGCTGCATCTAAATATTCCACCGTTGATAC
ACTGAAGCAGCAGTATCGTTTTCTTCCTGCTAAATATAAGNNNNNGACTG
CTATCTTATCTATATTCTGACTGAGATGTCTGGCAGTACATCTATGGTTT
TCACTCGCACATGTGATGCAACTCGTCTTCTGGCTTTGATGCTTCGCAAC
CTAGGCTTGAGAGCCATACCAATTAGTGGTCAGATGACTCAGNNNNNGAT
AAAAGGCTTGGAGCTCTAAACAAATTTAAGGCCGGAGAGTGCAATATCCT
TATATGCACTGATGTGGCCAGTCGAGGACTTGATATACCGTCTGTTGATA
TGGTTATCAACTATGATATTCCAACAAACTCAAAGNNNNNGATTATATAC
ATAGAGTGGGAAGAACTGCACGAGCAGGACGTTCCGGGGTTGCCATATCA
TTAGTAAATCAGTATGAGTTGGAGTGGTATATACAGATAGAAAAGCTTAT
TGNNNNNGGAAGAAACTACCCGAGTATCCCGCAGAGGAAGAGGAGGTTTT
GCTACTCTTGGAGCGTGTCACAGAAGCCAAAAGGATCTCATTGATGNNNN
NAAAATCAAAGAAACTGGTGGGAAAAGGAAACACAGAGGTGGTGGAGATG
ATGGTGACGATCAAGAGGTTCATAAATACTTGGGAGTTAATAAGAAGGGA
AAACAATCAAAGAAGCCAAAGAGAAAATGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g60990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4659 marker 4659
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)