Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker hp2

SGN-M4662
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the de-etiolated 1 locus.

Mapped locations  
Map: Pepper Capsicum   
Map version
65 (location: 42820)
Chromosome
1
Position
111.50 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40540)
Chromosome
1
Position
32.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35670
Forward primer (5'-3')
GATCCAATCCAACCATTTGC
Digested band sizes (using EcoRI)
Solanum pennellii LA716: 753
Solanum lycopersicum LA925: 303+450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GCAATGAGGGCAATTTAGGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 753
Solanum lycopersicum LA925: 753
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
hp2 was used as an overgo probe on plate 13 [well D3]

Plausible BAC Matches:   P238I13,   P017L24,   P265P12,   P274H08,   P118E13,   P336M04,   P139N11,   P159L11,   P279H04,   P264L01,   P079E01,   P248I23,   P311M10,   P179A02,   P006E23,   P238B03,   P197K06,   P299C22,   P103N19,   P223D15,   P222C02,   P211G05,   P262N19

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCTTACTATGCCCTTGCCCTTATC
B sequence
GAGTCAGTCCACCAATGATAAGGG
AB sequence
CCTTACTATGCCCTTGCCCTTATCATTGGT
Marker sequence
ACCTAAACCATATTTGACCAAATCCGTATTTACCCATATCCAATTTGGGT
AGATTGTAACCCAAACCATTTTTGCTCAATCCGATCCAATCCAACCATTT
GCCACCCTACTTCCATATACGTTCTCCGTGTAAAGGGAAGAAAACAAGCT
GTGCTCTTTAAGAAAATTAAGTTTTTTGTTTTGTTTGGTCGGTATATTTA
TCTTCTCCCCCCAACCCTCCCTTAAATTCTCTCTACAGTTTTACACACAG
CAATGTGTAAGTAATAGTCCTCTTTGGTTTAGTTTGGCAAGTATTTCTTC
ACTTTTCATGCCTCTATATAAAAAAAAAGGAAAAGAAAAGAAAATGTTTC
TTGTTTGGTTGTTGAGTGAATTCTCACTTTATGCTTATAATGCTTTCTCC
CTTCGTTGGAAAGTGCAGCTTTTTGCTTCGTAGCACCTCCAAACACACTT
CCCTATGAAGAGAATTTTCTTTAGATTTGGTGGGTATAGTTCCCTCTTGA
CCCTTTAATTTGGTTTTGTATGAATTTCTCTTCATTATTACCCATTTCCT
TTATATAGAAAGAAACTTTTGGTTTTGGTGTTTAATATGCTCAGTCAATT
TGATCATTCCCTCTAGCAAGGAAAAAAATCTGTTTATTTTATGAAGGAAA
AAAGGCCAAAAGCCCTAAAGTGCTCAACTATGGAAAATAGAACAATATTG
CCCTCCATTTGAATTTGATCCTTACTATGCCCTTGCCCTTATCATTGGTG
GACTGACTCAGATTTGCTCCTCAACTATTGGAAAAAGAACTAATTTGCTG
TCCGTATAAATTTGGTCCTAAATTGCCCTCATTGCGGATGAACTTGCTCC
AATTTGCCTATCAAAATTAACAGACCCTAAATATTTTATTTTTAAAACAG
ATTATATTTAAGTCCCAGTTACAAAAAATAATATTATATTTATTAAAAAA
GAGAGTGCTACCCTGAAAGATAATAATCTTAATGCTTAAATGTTCTTGTA
AAGACAATTGCTCAAAGCAATTATACAAACCGTAAAAACTTGGGATAGAT
CTAATTTCTCATCATGATTCTGTCTTCCCCCCATTAAAAAAATCTTTACC
CTCATGATGTTTAACAAATTAAAATACAACACATTCAGCAAATTGGAGAT
CTTAAAGAGAGAATAAATAGTCTTCAATTTCTGAATATCGAATTGAAAAT
TCTCAAAGATGTGATATATAACTTAAAGTAAATGAAGAAATTTGAAGTAC
ACTTCACAAAAGTTTTTGATCGTGCTGAAGAAATTGCAATTTTGTCATGT
CAAAAAAGAAAAAAATTGGTAAATGTATCAATTTTATATTTGTTGAACTA
AATTTGTGCGTATGATCGCAATTGTGACACAGAAGTAATGATCTTCAAAG
AGACAATTATTAGTCATCGGTTGAGCAAAAAGGAATGATTAGGGAAATAT
TGCTCATCCCTTTTTTATGTGTATTTCTTAAGAAAATATAACTTCTACAT
ATTCTTTTTTCTTCTCCTCGACTCTTTTTCTTCCTCCCGTCATTCTAGAA
AATAGAAGTCAAATAAACCATTGACTTCAATGAAATGGCTGATTGAAAAA
ATGTGAATCATTAGTTTGGAGAGGCAAATTGAGTGTTTTCTTTAACGTTA
AAAGCATATTTGTGTTGACATACTCACTAGTTTGTTAGTTTGTTATCAAT
TCTTATCAAGTTATCAAGTTGTTAGAGTAGATTTAGATTAAGTTGTTAAA
GTAATTCCTTAGATTTAGTCAACTTATTTATATATTAAGTTGTTAGAATA
GTTCCTAAGAATTAGTCAAGTTAGTTACATCTTACTTGTATTTAAGTTGA
TGCTATGTTTGAATAAAAGACATTCAAGTTTGCTTTGATTCTCAATCTCT
TTATGGTATCAGAGCCCCTCTAAAACTCTGACGAGTTCGATCCAATTTTT
TTCCCCTCTCTTTGCGTCCAAACATGGTTATTCTTGCTACCACCACTGAA
AGTGCTGCTGCAGTTCCGACTACCACTCATGTGGTACAATTTAATCCAGC
TGCCCAATTACCGATCAAACTCAAGGTAACCTCAATTTCGCAACCTGGAA
AGCGAGGTGATGCTACTCAATGGACACAAGCTCCTTGGGCATCTCACTGG
TAACAAATCTGCTTTGCCAACCACTATCACACAAACTGATAGTACCATCT
CCAATTTTGAATATGAGTTGTGGTTTTGCCAAGACCAACTAATTCAATAG
GCAATGATGACATCCGTTGAAACCACCATTGCTCCCACTATTGCAGCTTC
CGCTTCCGCAAAAATAACTTGGGATATCCTTCACACATCTTTTGCCAATA
AGAGTCACACTCGCATCTTCAGCTTGCGAGGTCAGTTGCAAAACATGAAA
AAGGCCTCCAAGACGGTTGCTACTTACCTATAGGAGATCAGATCGATTGC
TGATGCTCTCAGAGTAGTAGGTTCTCCGGTGGCTGATAATGAGCTAGCAG
TAAAGATTGAGTGGCCTAGGTAATGAGTACCATGAAATCACTGTTGCTAT
AAGAGCGCGCGACACAACCTTAAGCTTTGAGGAGCTATTCCAGAAAACTC
ATGGACCATGAACTCTTCCTCAAACATTAAGACATTTACAGGTCATCCTC
CATCATCGTGGCTGCAGTTGTACAAAAGACCAACTTCCAACCCCAACATT
AGAAGAATAATTGTCGCTTCCCAAATCAGTCTTCAAGACCACAACCCCCA
CGACAGGCGGTTCCTCGAAATCAATAGAATGGGAGACTACCCAGGCAGGC
GGTAAAGTGCCAACTTTGTCAAAAGATCGGTCCCACAGCTGATGTGTGTC
GCTCAAAATCGCACAACCACTTTGAAGCTAAGGTCAACTTTGTTTCAAAT
CATCACTCAGATGCATCTCTTTGGATCCTTGACTCTGGAGCAACCCATCA
TGTCAAAACAGAGTCAAATAATCTTGAAGAATAATCCGACAATGAGGAAG
TTTCCATGGGTGATGGTAAAACTATTCCCATTACTCACACTGGTTTAACT
CAACTTAAGGCTTCTAATTCCAATTTTGTGCTCTCTAACTCTGTGCTCCA
GCTATAAAAAAAAACCTTATATCTGTTGCTATGTTTTGCACTGACAATCT
GACCTCAATCAAATTTTTTCCACTCTTGTGAAGGATCTCAAAACTCGGAG
ATTGCTGGTAGAAGGCCAGAATAAACATGGACTCTATGAGTGGCCCAGAG
GGATCATGTGTCACCTTCCGCCAACTTCACCTCCACCAAAGATTCCCCTC
AACTCTGGCATCGTAGCTTGGGTCACCCTCATCTGAAAATCTTAGACTTA
GAACTTAATGAGTTCACTTCCCTTTACCCCAAAAGAAAAGTTTCATTTTG
TAATTCGTGCTCATCAAATAAAGCTCATCATTTGCCATTTCAACGACTCA
CTTAAAATAGTAATGCACCACTTCAAACTTTGTTTAGTGATTTATGGGGT
CCATCACTCATGTTATCCATTGATAAAAAGTTGTATTACTGCATTTTTGT
TGATCATTACACCAAATATACTTGGTTGTATACAATCAAAAATAAAAATG
AAATCGCTTCAATTTTTGCAAACTTTCATGCTTTAGTGGAAAAAAATTTT
AAACACAAAATTGTCTCACTTTATACTGATGGAGGGGGTGAATTCACAGG
TCTTAAACAATACCTACAATGCCATGGCATTGAACATTTGATCTTTCCAC
CCTACGCGCCCCAATGAAATAGTCACATTGTCAAAACGGCTCGAATTCTT
CTCAATGAAGCCTCACTACCATCTGAATTGTGGTCCTTTGCCTGTCATAA
TGCAATCTATCTCATAAATAGACTCCTTATACCTGGCCTGAATAATGAGC
GACGACATAGTCACATTGTCAAAACGGCTCGAACTCTTCTCAATGAAGCC
GCACTACAATCTGAATTTTGTTCCTTTGCCTGTCATCATGCAATTTATCT
CATAAATAGACTCCTTACACCTGGCCTGAATAATGATTCTCCGTATAAGA
AATTATTTGGCAAACCACCAAAATACTCTTCACTGAAAATTTTTGGTTGT
CTTTGTTATCCATGGCTTAAGCCATATACACAAAATAAGTTTCAGCCTTG
TGTCTAATTAGGATTTTTTATTGTTCATCATGCACACCTCTGCTTTGGTC
CAGTGCACTCAAAAATTTTCGTCAGTCGTGATGTTCATTTTGTGAAGACA
TTTTTGCTTTCATTCAAATGTTCTCACACTTGCAAAATAAGTTTTCCAAG
TTACAATGGGAAATCATAGAGTCCCAAGTTTGTAAGGATACTCAGCCAGC
AATCCAATTAAATTTGGACTCCAATCTAGTTCCAACTCTTCCACCTCCTA
TTCCTATCACTCCTATTCCTATCACCTTAACAGTTCCCTCTAATTCAAAC
ACACCAGAGTCCAGAATTGAAAGGCAGTTTACCAACAATGTCCACTTCAT
CAGCAATGATTCCTATCTCTACTCAACCTCCTTCACTACTTAATGAAGCA
GCCCACAACTCTCACCCATTACTCGATTCTCATCGTCCATCACACAACCA
ACATCCACCGAATCCACCAGCAATTATGCCCCCTCTACCATTCGATGTTG
TCACAAGGTCCAAAAATAATATCTTCACACCAAAGAAAAAATTCAGCTTC
TTGGCTCCCCTTTCTCCCACTCCAAATACCTTTAAGCAAGCTGTTAAGCA
CATTGAATGGAAGAGTGCAACGGATATGGACTACAAAGCCTTAATGAGAA
ACCAAACTTGGGAACTAGTACCTCGGAACCCGATAAACAATGTTGTTGAT
TGTAAGTGGTTATTTCGTATTAAAAAAAAGGCTGATGGTTGTATTGATAG
GTACAAGGCGTGATTAGTCGCAAAAGGTTTCACACAATGTCCAGGATTGG
ATTTTCATGAAACTTTCAATCCGGTTGTCAAACCAACCACCATCAGAATT
GTCCTTTCTATTGCAATTCAAAATAACTGAAAAGTTCAGCAACTTGATGT
GAATAATGCATTTTTGCAAGGTAACTTATAGGAGAAAGTATTCATGGCAC
AGCTGAAAGGCTATGTCAACCCTGATTTTCCAAATCATGTCTGTCGTCTC
AAAAAGACCATTTACGGCATGAAACAAGCTCCTCGTGCCTAATATGAAGC
TCTCAAATCTCACTTGACTACAATTGGGTTTGTTAATTCTGAATCAGATG
TTTCTCTATTTATTTTCACATCCGAAACTGTCATGATGTATATTATAGTG
TATGTTGATAATATCATCATTAGTGGAAATTACCCAACCTTGGTCACACA
TGTAAACTCTCTGACAACTTTTCCCTAAAGAACCTTGGTGGACTCAACTA
TTTTTTGGGGATCGAAGTTAAACATGTTCCAAATAGGATTGTCTTATCAC
AATCCAAATACGTACTTGAGATTCTCTCATATGCGGATATGTACCCATGT
GCTCAAGCTCACCACCCAAAGCAGGCGATGGTTCACCTACTCCCGAAACA
ACCTTGTATCGACGACTATTGGTAAATTGCAATACTTATTATTCACGCGC
CACACGCCTTGATATTCCTTTGCAGTTAATCAACTATCACAACTTATGCA
ATCTCCAAATTTGGAGCATTTGAATGCAGTAAAAATGGTGCTGCGATACC
TCAAGGCATCATCAACGTCGTGTCTGCAAATCTCTAGCCACTCTGATAGT
AATCTGTATATTTATGTTGATGCTAAATGGGCAGGTGATCCTTGTGACAG
AATCTCCACATTTGGTTGCATACTCTTCTTGGGCCAAATTCGACCTGTTG
GTCCTCTAAGAAGCAACAATCAGCTGCTCGTTCCTTTACTGAAGCAAAAT
ACAATCGGTAGCCAATGCACTCTCTGAACTTACTTGTAGGTTCTTGATTG
AAATGCGATATCAAGTCTTGCAAACACCAAGCATTTTTTGTGATAATATT
GGCGTTTCATATCTCAGCAAAACCCCCGTCTTCCACGCTAAGATGAAGCA
CATTGCAGTAGATTTCACTACCTCCGCAACAGTGTAAACTTAGGTAGAGT
AATAGTCAAATATCTTCCTGCAGGGGATCAAATTGCAAACATTCTCACAA
AGCCGCTGCCCAAGCCCGCCTTCCTTCGATGTTTATTAAGTTAGGCGTTG
TTGCACCACACCTAACTTGAGGGTGTGTCTTGACATACTCACTAGTTTGT
TAGTTTGTTATCAATTCTTATCAAGTTGTTAGGGTAGATTTAGATTAAGT
TTTTAAAGTAGATCGTTAGATTTAGTCAACTTAGTTATATATTAAGTTAG
AATAATTCCTTAGAATTAGTCAAGTTAGTTATATCTTACTTGTATTTGAG
TTGATGCTACGTTTGAATAAAAGTCATTCAAGTTTGCTTTGATTCTCAAT
CTCTTTAATTTGAGACCAAATCCAAATGGAGGGTAAAATTGTTCTATTTA
TTTAGGGCCTATGAATAGTTGGTAAGCATGTTTGGTCCTTTTTCCTTTTA
TGAATATTATCACTATTTCCACATCGATGCATTTTTCTCCATCGTGGAAA
AAAGAGAGTTCTTTTTTGTTTAGGGGGTATGCAACAGACTATGGAAGAGA
CAAACAACTGATGAAAGGTTTTTGACTTGATTGCGCTCAGTTACATCCCA
TGATAACCGTGCCCTTATTGACCCAGTAAACATTAGTGAGTTGGGTCATT
GATGCAAAGGATTGGGTGTCGAGCCGAGCTTTAGCGAGCCCAATCGACCT
GATCAGTTGAGCTTAGCCTATGTGAACTCTTCAATGTTTAGTTCTATATA
CTACTATGTCATTAAAAAATATTTAATTTATAACAAATTGGTTAATCAAG
AAAAATAAGTATTAGGGGTCGTTTGATAGGTGTACAAGAATCGTGTTGAG
TAGAGTATATTAGTAATGTTGGTATTAATATGTTGACATTATGCGGAGAT
TATTTCTTATGCACGGTTTGGTTTGGTGTAAATAACATGCTTTGCATAAT
ATCTGAAAATAATTATTTGTTTACAAAAACACCCTCCACAAATGTGTGGG
AAGGACGTGGGAACACTAAGGGCAATTGTGTCTTTAACCATGCTAATGCA
TGCACTAAAAATCCTCACATTGCTAATACCATTGTTCGTCATCTATCAGT
TATACATAGCATGATACCAAAAAGATGTACAAAAAAAAGAAGGTATTAGT
AATGCATAAAACTAATGTCTTATTTTTTTTTTCTAATGCATCCTTGCAAA
TGACCCTGTAGTATAATTTGGTTATTGCATTCAAGTGTGATTGAATTATA
TGTATAATTTGGTTATCGCATTCAAGTGTGATTGAATTCTATGTGTTATT
AGTTTAAGTTAGACCTTAAATTTAAATGAAGGTAATTTTATATTAAACAT
AGAATAGAATATTCAGAAAAAAATAATATAAAAATCACAATACATTCAAG
AAATCTGTACAATATTAATTTTCTTTAATTTTTGAGTTCTTGAACTTAAA
ATATTTAATAACATTTTTCACTACCCATAAAATATTTTTAGTAATGATGT
CTAAAAAAATAATTACATAAATTTTTTTAAAGGAGTACAAAATAAATTTG
TTAATAGTAAATAATAATTATTGAATTAACATCTTGCTAACTTGACTAAG
ATTAATGGATTAATTTTTGTTTTAAAGCATGATCAAAACAAGCCAACCAA
GCCGGCTCAACCTAGTCCTAGTTTTAATAGAGACTAGCTTAATTTTCACC
AAAACTAAGCTGAACTAAATACAGGCGAGAAAAGCCGAGTAGTAACGTGC
CATTTGATAACATAGTCTGGGTTGAGAGAGTTATCCTTAGTGGATGAACA
TTTCATCTTATATCTAACAATAAGCCGAATCATCTAGGCTTATTTTCTGC
AACAGTGGATGATATTTGGTCATTTTGAGCAAGTTGATAGGAGGGTATTT
TTGTTTCTTTGCAAATTTCAGATCTAACTGCAGATATATTAATATTGCAA
CCATTTTGAGAATAATTTCCAATTAGATTACTGTTAGTCCTTCATGTACA
ATCTTGTTTTGTATCATTCTGATACTTCAGAATTTTTTCAGAGCGTGCAA
TTTCTTTGCAGCAATTTGTTGGATCTACTCAGCCCTCTCATCCATACCGC
AATGTGTATTTTTTTGCTTAATTGCAATATATAAGTGTTAATTCTATATA
TAAGTTTGGAAATTTTCTTGTGAGCGGTTTAAATTCCTTATTAGCCTTCT
ATTGCAGCTTATTTCAGCTATTGACCGCCATAGACAGTCTACTGACCATC
CAATCAAATTCATTTCTAGAAGACAACCCAATATCCTGAAATTCAAAATG
AAGCCAGGTACGGACTTTTTTATTTATAATTGTTGACATGCTTCATCTTC
TGGTGGTAAAACTTGGCTTGTTTTCTTATGCTGCTTATTATTAAAGTACA
TTTACTATCAGGACCTGAAGCTGGCAGCACAGATGGGCGAACTAAGAAGA
TCTGTTCCTTCCTCTTCCACCCAATATTACCCCTTGCACTTTCTGTTCAA
CAAACCTTGTTTCTGCAGGCATCAGTTGTAAATATCCATTTTCGTCGATA
ATGTAAAAACTTAATTTATATGTTACCGATTTGTTTATAAATTTCTCTAA
TAACCTCTAGATTGAAATCAACCTAGAAATCACAAATTCATCATAACAGA
CCCGTAGATGCTAGTGTCTTTGACTTCTACATTTTCTTTGTTACAAGAAT
CAAACAAATGCTTGATAGAGTGCCAAGACGGTTAGTATGGGTATAAGGAT
TAGTTCTTCTGTAAGTTTTTGTTACAGCTTCTCTTCTAATTAATTGATGT
ACATTCAGATGTTTATTTGTGAGGTAGAAAACTGATGAAGACCCATTTTT
GGTTATCTATGGATACTGTAGACTATGGTACACAAAATCTTTTACCTGTA
TCAGCTGCTTTGGGATGTTTAAGTCAGAATAAAGGAAGATGACATATAAC
TAGATTTTCCATTCGTTGTATTTCTAATTCTGTCAGCATTCCTTTTGGTT
TCAATTAGAAAAGCAATATGATGATGCTTGAACGAATTTGGATGAAGCAA
GTTCGTGAAGAACTTTTGGTATGAATTAGGAGTGATTAACAGTTAAGTTG
AATATAAGTCGATCAAATGTTAAATAAAAATGGGTCAAATGCAGAACTTG
CTTCATATTTTAAACGAGTAAAAATGAGTTATCCAAGGGATAATATTGAT
AAACATGGATATATATTATTATAGTATAGAGATTGTGCTAAAAGCTAAAG
GCGAAATGGTTCTTGTACTTGTGTCTGCTTGTATTATGGACACATCTACT
TACCCTTTTTGTCATCCTGACCCTTGAAGCCATCAAACCCACATTTTAAA
Genomic location of hp2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4662 marker 4662
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)