SGN Marker C2_At4g09010

SGN-M4663
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300205 (SGN)
122397 (CGN)
---
Capsicum annuumSingleSGN-U204785---
Lycopersicon CombinedSingleSGN-U218672---
Solanum tuberosumSingleSGN-U258329---
ArabidopsisSingleAt4g09010 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41466)
Chromosome
4
Position
106.30 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43442
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GTGTATTCTTTATTAATGAAGCTTGCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38623)
Chromosome
4
Position
82.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39809
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
Accessions and product sizes
Solanum lycopersicum TA209
570
Solanum pennellii TA56
570
Approximate temperature
55°C
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300+340
Solanum lycopersicum TA209
570
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26637)
Chromosome
4
Position
5.78 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11358
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 570
Approximate temperature
55°C
  
PCR data   Exp. ID 11359
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 570
Approximate temperature
55°C
  
PCR data   Exp. ID 11360
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 570
Approximate temperature
55°C
  
PCR data   Exp. ID 13372
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13373
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13374
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13375
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13376
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13377
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13378
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13379
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13380
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13381
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13382
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33080
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33081
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33082
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11361
Forward primer (5'-3')
TAAGGGGCTTGATGCTGCTTTG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 300+340
Solanum lycopersicum LA925: 570
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAAGGTCGATTTGACTGCACTTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, MspI,RsaI,DraI,TaqI,RV,HinfI,DpnII,KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 570
Solanum lycopersicum LA925: 570
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g09010 was used as an overgo probe on plate 13 [well D5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATTCTTGGGTCCTGATCAAGCTG
B sequence
AGTAGGGCCTCTGTTGCAGCTTGA
AB sequence
CATTCTTGGGTCCTGATCAAGCTGCAACAG
Marker sequence
ATGGTCTCTTTTGCTTCAACACTTCCCTCTTTGGTTTCATTCATTCCTTC
ACCATCTTCCATTACCAATGCCTCAAGAAACCCTCCTCAACCTNNNNNGG
TATGATTTGTTGTAAGTTTAGATCAGAGCTTAATAATGAAGATCGCTTTC
ATAGACGTGATATTCTTCAATCTGTTGGAGCAGCAGTAGGCNNNNNATGG
ACTTGATAGCAAGATCGAGTGCATTCATCGAAGTAGCTAATGCTGCTGAT
TTAATACAACGCAGACAGCGGTCAGATTTTCAATNNNNNCAAAGATCAAA
CTGACTCTTTATGATGCTATAAAGGCAAATCCGGATATAATTCCATCCTT
ACTAACTTTAGCACTTAACGATGCCATAACATATGATAAGNNNNNGCAAC
AAAAACCGGGGGTCCCAATGGATCCATACGTTTCAGNNNNNCTCAGAGAT
CAGCAGACCAGAAAATAAGGGGCTTGATGCTGCTTTGAATTTGTTGGAGG
AATCAAAGAAGGTTATTGATTTAGATTCCAAAGGTGGACCAATCTCATAT
GCAGATCTCATCCAATTTGCTGNNNNNCACAAAGTGCAGTCAAATCGACC
TTTATCGCTTCTGCAATTAGCAAATGTGGTGGTAATGTAGAGAAGGGGAC
TTTGTTGTACTCTGCATATGGTTCTAATGGACAGNNNNNTGGGGCCAATT
TGATAGGATATTCGGGAGGTCAGATGCCCAGGAGCCTGATCCAGAGGGAA
GGGTGCCTCAGTGGGATAAAGCAAGTGTGCAGGAAATGAAAGACAAGTTC
AAAGCTGTTGGCTTGGGCCCTCGTCAGNNNNNTTAGCAGTAATGTCTTCA
TTCTTGGGTCCTGATCAAGCTGCAACAGAGGCCCTACTCGCCAGTGATCC
AGAAGTTCTTCCTTGGATTCAGAAGTACCAAAGGAGCAGGGAAACAGTGT
CTCGAACTGATTATGAGNNNNNGTTGACTTGATTACTACTGTTACAAAAT
TAAGCAGTTTGGGACAAGTAATAAACTATGAGGCATATACTTATCCTCCC
AGGAAAATTGATGTTACCAAACTCAAGTTGTAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At4g09010  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4663 marker 4663
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)